Incidental Mutation 'R1477:Ezh1'
ID164145
Institutional Source Beutler Lab
Gene Symbol Ezh1
Ensembl Gene ENSMUSG00000006920
Gene Nameenhancer of zeste 1 polycomb repressive complex 2 subunit
Synonyms
MMRRC Submission 039530-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1477 (G1)
Quality Score187
Status Not validated
Chromosome11
Chromosomal Location101191115-101226463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101192984 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 733 (D733E)
Ref Sequence ENSEMBL: ENSMUSP00000102905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100417] [ENSMUST00000103109] [ENSMUST00000107284] [ENSMUST00000107285]
Predicted Effect probably benign
Transcript: ENSMUST00000100417
SMART Domains Protein: ENSMUSP00000097984
Gene: ENSMUSG00000006920

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 1.8e-20 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
PDB:4MI0|A 521 558 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000103109
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107284
AA Change: D733E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102905
Gene: ENSMUSG00000006920
AA Change: D733E

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.5e-21 PFAM
SANT 135 263 3.86e1 SMART
low complexity region 369 381 N/A INTRINSIC
SANT 430 478 3.03e-4 SMART
CXC 556 593 8.14e-2 SMART
SET 613 734 7.34e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107285
AA Change: D736E

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102906
Gene: ENSMUSG00000006920
AA Change: D736E

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 42 71 5.1e-20 PFAM
SANT 138 266 3.86e1 SMART
low complexity region 372 384 N/A INTRINSIC
SANT 433 481 3.03e-4 SMART
CXC 559 596 8.14e-2 SMART
SET 616 737 7.34e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138835
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Polycomb-group (PcG) family. The encoded protein is interchangeable with the related Enhancer of zeste 2 (Ezh2) protein as a core component of the polycomb repressive complex 2 (PRC2), which methylates histone H3 at lysine 27 and results in the transcriptional repression of affected target genes. This complex is involved in carrying out cell-fate decisions during embryonic stem cell differentiation. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and healthy. Mice homozygous for a conditional allele activated in hematopoietic stem cells exhibit bone marrow failure with defective HSC maintenance and premature senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Acsl5 A C 19: 55,291,472 D481A probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Arfgef1 A T 1: 10,189,284 C619S probably damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Meis1 G A 11: 18,881,665 Q458* probably null Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Mus81 G T 19: 5,486,334 H155Q probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Nox4 T C 7: 87,295,866 V79A probably benign Het
Olfr212 A T 6: 116,516,665 Y296F probably damaging Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr61 T A 7: 140,638,442 I247N possibly damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Prdm4 C T 10: 85,904,265 V424I probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Vps35 T A 8: 85,287,800 E73D probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Ezh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Ezh1 APN 11 101194506 splice site probably null
IGL00481:Ezh1 APN 11 101199302 missense possibly damaging 0.68
IGL01327:Ezh1 APN 11 101203436 missense probably damaging 0.97
IGL01475:Ezh1 APN 11 101192961 missense probably damaging 1.00
IGL01693:Ezh1 APN 11 101215258 missense probably benign
IGL01896:Ezh1 APN 11 101213755 missense probably benign 0.00
IGL02022:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02024:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02028:Ezh1 APN 11 101199340 missense probably damaging 1.00
IGL02053:Ezh1 APN 11 101199943 splice site probably benign
IGL02101:Ezh1 APN 11 101195566 missense possibly damaging 0.50
IGL02445:Ezh1 APN 11 101210687 missense possibly damaging 0.49
IGL02882:Ezh1 APN 11 101203289 missense probably benign 0.02
IGL03303:Ezh1 APN 11 101195671 splice site probably null
IGL03493:Ezh1 APN 11 101203791 missense probably benign 0.02
R1099:Ezh1 UTSW 11 101193808 critical splice acceptor site probably null
R1119:Ezh1 UTSW 11 101210535 splice site probably benign
R1434:Ezh1 UTSW 11 101194917 missense probably damaging 1.00
R2114:Ezh1 UTSW 11 101208185 missense probably benign 0.04
R3105:Ezh1 UTSW 11 101195642 missense probably damaging 1.00
R3106:Ezh1 UTSW 11 101195642 missense probably damaging 1.00
R4272:Ezh1 UTSW 11 101194908 missense probably damaging 1.00
R4820:Ezh1 UTSW 11 101203768 missense probably damaging 1.00
R5016:Ezh1 UTSW 11 101199237 intron probably benign
R5237:Ezh1 UTSW 11 101216993 critical splice donor site probably null
R6392:Ezh1 UTSW 11 101203804 missense probably damaging 0.96
R6892:Ezh1 UTSW 11 101199361 nonsense probably null
R7215:Ezh1 UTSW 11 101215299 missense probably benign 0.01
R7488:Ezh1 UTSW 11 101200900 missense possibly damaging 0.51
R7604:Ezh1 UTSW 11 101217029 missense probably benign
R7819:Ezh1 UTSW 11 101194914 missense probably damaging 0.98
R8696:Ezh1 UTSW 11 101209479 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGCGCAGCTTCTTACATCTGAAC -3'
(R):5'- TCACCGCATTGGGATCTTTGCC -3'

Sequencing Primer
(F):5'- CAGTGTGTCCCCTTGGAATAAAG -3'
(R):5'- GGATCTTTGCCAAGAGAGCAATTC -3'
Posted On2014-03-28