Incidental Mutation 'R1477:Mus81'
ID164160
Institutional Source Beutler Lab
Gene Symbol Mus81
Ensembl Gene ENSMUSG00000024906
Gene NameMUS81 structure-specific endonuclease subunit
Synonyms
MMRRC Submission 039530-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R1477 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5482345-5488402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5486334 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 155 (H155Q)
Ref Sequence ENSEMBL: ENSMUSP00000114895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025841] [ENSMUST00000070118] [ENSMUST00000116560] [ENSMUST00000124334] [ENSMUST00000126471] [ENSMUST00000209469] [ENSMUST00000168330] [ENSMUST00000167371] [ENSMUST00000165485]
PDB Structure Solution NMR structure of the Mus81 N-terminal HhH. Northeast Structural Genomics Consortium target MmT1A [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000025841
AA Change: H155Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025841
Gene: ENSMUSG00000024906
AA Change: H155Q

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 7e-3 SMART
PDB:2KP7|A 11 90 5e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 1e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070118
SMART Domains Protein: ENSMUSP00000064719
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
EGF_like 73 113 2.74e-1 SMART
low complexity region 115 130 N/A INTRINSIC
EGF_CA 142 182 1.08e-10 SMART
EGF_CA 183 221 1.94e-12 SMART
EGF_CA 222 261 1.36e-7 SMART
EGF_CA 262 301 2.19e-11 SMART
EGF 305 347 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116560
SMART Domains Protein: ENSMUSP00000112259
Gene: ENSMUSG00000056201

DomainStartEndE-ValueType
ADF 19 154 5.3e-56 SMART
low complexity region 195 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124334
AA Change: H155Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114895
Gene: ENSMUSG00000024906
AA Change: H155Q

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 9e-3 SMART
PDB:2KP7|A 11 90 9e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 3e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126471
SMART Domains Protein: ENSMUSP00000121435
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
PDB:2KP7|A 11 72 8e-21 PDB
Predicted Effect unknown
Transcript: ENSMUST00000133436
AA Change: H119Q
SMART Domains Protein: ENSMUSP00000118580
Gene: ENSMUSG00000024906
AA Change: H119Q

DomainStartEndE-ValueType
PDB:2KP7|A 2 55 5e-30 PDB
low complexity region 57 72 N/A INTRINSIC
PDB:2MC3|A 86 194 8e-50 PDB
ERCC4 235 337 8.31e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151932
Predicted Effect probably benign
Transcript: ENSMUST00000209469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154215
Predicted Effect probably benign
Transcript: ENSMUST00000168330
Predicted Effect probably benign
Transcript: ENSMUST00000167371
SMART Domains Protein: ENSMUSP00000129746
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 161 1.94e-12 SMART
EGF_CA 162 201 1.36e-7 SMART
EGF_CA 202 241 2.19e-11 SMART
EGF 245 287 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164204
SMART Domains Protein: ENSMUSP00000128414
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Pfam:EGF_CA 37 69 5.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165485
SMART Domains Protein: ENSMUSP00000133016
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 163 1.08e-10 SMART
EGF_CA 164 202 1.94e-12 SMART
EGF_CA 203 242 1.36e-7 SMART
EGF_CA 243 282 2.19e-11 SMART
EGF 286 328 1.95e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous and heterozygous null mice for one allele display increased tumor incidence and reduced life spans. Homozygous null mice for a second allele display normal life span and tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Acsl5 A C 19: 55,291,472 D481A probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Arfgef1 A T 1: 10,189,284 C619S probably damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Ezh1 A T 11: 101,192,984 D733E probably damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Meis1 G A 11: 18,881,665 Q458* probably null Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Nox4 T C 7: 87,295,866 V79A probably benign Het
Olfr212 A T 6: 116,516,665 Y296F probably damaging Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr61 T A 7: 140,638,442 I247N possibly damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Prdm4 C T 10: 85,904,265 V424I probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Vps35 T A 8: 85,287,800 E73D probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Mus81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02120:Mus81 APN 19 5485633 unclassified probably benign
IGL03140:Mus81 APN 19 5483956 missense probably damaging 1.00
IGL03370:Mus81 APN 19 5484963 unclassified probably benign
city UTSW 19 5487793 missense probably benign 0.30
country UTSW 19 5484211 missense probably damaging 1.00
R0116:Mus81 UTSW 19 5486524 missense probably damaging 1.00
R0480:Mus81 UTSW 19 5487931 unclassified probably benign
R1243:Mus81 UTSW 19 5485117 missense probably benign
R1439:Mus81 UTSW 19 5485117 missense probably benign
R1795:Mus81 UTSW 19 5483476 missense probably benign 0.00
R2346:Mus81 UTSW 19 5484963 unclassified probably benign
R2863:Mus81 UTSW 19 5486500 missense probably damaging 1.00
R3785:Mus81 UTSW 19 5485361 unclassified probably benign
R5312:Mus81 UTSW 19 5483494 missense possibly damaging 0.79
R5489:Mus81 UTSW 19 5487889 unclassified probably benign
R6037:Mus81 UTSW 19 5484004 missense probably damaging 1.00
R6037:Mus81 UTSW 19 5484004 missense probably damaging 1.00
R6970:Mus81 UTSW 19 5485526 missense probably benign 0.45
R7037:Mus81 UTSW 19 5486080 missense probably damaging 1.00
R7060:Mus81 UTSW 19 5487793 missense probably benign 0.30
R7100:Mus81 UTSW 19 5484211 missense probably damaging 1.00
R8355:Mus81 UTSW 19 5484192 missense probably damaging 1.00
R8455:Mus81 UTSW 19 5484192 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACCTGTGAAAGGGATGGAGACC -3'
(R):5'- TCGAGAGATCCTGCTGCAACTCTAC -3'

Sequencing Primer
(F):5'- ATGGAGACCCTCAGAGAGTCC -3'
(R):5'- CTGCAACTCTACAGGGAGC -3'
Posted On2014-03-28