Incidental Mutation 'R1586:Surf2'
ID177486
Institutional Source Beutler Lab
Gene Symbol Surf2
Ensembl Gene ENSMUSG00000014873
Gene Namesurfeit gene 2
SynonymsSurf-2
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1586 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26916367-26920183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26919755 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 239 (F239S)
Ref Sequence ENSEMBL: ENSMUSP00000015017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015011] [ENSMUST00000015017] [ENSMUST00000015934] [ENSMUST00000129682] [ENSMUST00000133513] [ENSMUST00000147110] [ENSMUST00000167661] [ENSMUST00000153641]
Predicted Effect probably benign
Transcript: ENSMUST00000015011
SMART Domains Protein: ENSMUSP00000015011
Gene: ENSMUSG00000014867

DomainStartEndE-ValueType
Pfam:SURF4 4 269 5.7e-132 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000015017
AA Change: F239S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015017
Gene: ENSMUSG00000014873
AA Change: F239S

DomainStartEndE-ValueType
Pfam:SURF2 4 251 5.7e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000015934
SMART Domains Protein: ENSMUSP00000015934
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
Pfam:SURF1 106 321 6.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128665
Predicted Effect probably benign
Transcript: ENSMUST00000129682
Predicted Effect probably benign
Transcript: ENSMUST00000129822
Predicted Effect probably benign
Transcript: ENSMUST00000133513
SMART Domains Protein: ENSMUSP00000141317
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:SURF1 30 63 7.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150776
Predicted Effect probably benign
Transcript: ENSMUST00000183520
Predicted Effect probably benign
Transcript: ENSMUST00000147110
SMART Domains Protein: ENSMUSP00000141238
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:SURF1 30 240 5.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167661
SMART Domains Protein: ENSMUSP00000128488
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 51 66 N/A INTRINSIC
Pfam:SURF1 73 290 5.9e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153641
SMART Domains Protein: ENSMUSP00000124720
Gene: ENSMUSG00000014867

DomainStartEndE-ValueType
Pfam:SURF4 4 82 1.9e-33 PFAM
Meta Mutation Damage Score 0.1838 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares a bidirectional promoter with surfeit 1 (SURF1; GeneID: 6834), which is located on the opposite strand. It encodes a conserved protein that is expressed in a variety of tissues. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Surf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02637:Surf2 APN 2 26919778 missense probably damaging 1.00
R7302:Surf2 UTSW 2 26918882 missense probably damaging 1.00
R7468:Surf2 UTSW 2 26919342 missense probably benign 0.42
R7985:Surf2 UTSW 2 26919276 missense probably benign 0.01
X0062:Surf2 UTSW 2 26916421 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGACTGCTCAGGAACTTCACTGC -3'
(R):5'- CGCTGCCATCTTCTGAACAGAACC -3'

Sequencing Primer
(F):5'- GGTAGACAAAGTCTCTAGTCACCTG -3'
(R):5'- TTCTGAACAGAACCTCCAGGC -3'
Posted On2014-04-24