Incidental Mutation 'R1586:Wdr93'
ID177509
Institutional Source Beutler Lab
Gene Symbol Wdr93
Ensembl Gene ENSMUSG00000039099
Gene NameWD repeat domain 93
SynonymsEG626359
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1586 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79743163-79785950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79768361 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 277 (D277E)
Ref Sequence ENSEMBL: ENSMUSP00000037467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035622]
Predicted Effect probably damaging
Transcript: ENSMUST00000035622
AA Change: D277E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037467
Gene: ENSMUSG00000039099
AA Change: D277E

DomainStartEndE-ValueType
low complexity region 240 251 N/A INTRINSIC
low complexity region 265 274 N/A INTRINSIC
SCOP:d1jofa_ 389 607 7e-4 SMART
Blast:WD40 413 451 2e-11 BLAST
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Ulk1 A T 5: 110,789,516 F638Y probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Wdr93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Wdr93 APN 7 79775553 missense probably damaging 1.00
IGL01910:Wdr93 APN 7 79771573 missense probably damaging 1.00
IGL01977:Wdr93 APN 7 79752505 missense probably damaging 1.00
IGL01979:Wdr93 APN 7 79776652 missense probably benign 0.03
IGL02191:Wdr93 APN 7 79749220 missense probably damaging 0.98
R0008:Wdr93 UTSW 7 79758473 missense probably damaging 1.00
R0008:Wdr93 UTSW 7 79758473 missense probably damaging 1.00
R1136:Wdr93 UTSW 7 79773448 missense probably damaging 1.00
R1168:Wdr93 UTSW 7 79749174 missense probably damaging 0.99
R1605:Wdr93 UTSW 7 79771509 splice site probably null
R1651:Wdr93 UTSW 7 79750082 missense probably benign 0.00
R3078:Wdr93 UTSW 7 79752493 missense possibly damaging 0.81
R3689:Wdr93 UTSW 7 79771585 missense possibly damaging 0.91
R4013:Wdr93 UTSW 7 79768411 missense possibly damaging 0.90
R4771:Wdr93 UTSW 7 79776763 missense probably damaging 0.99
R4824:Wdr93 UTSW 7 79750069 nonsense probably null
R4887:Wdr93 UTSW 7 79785774 missense probably damaging 1.00
R5172:Wdr93 UTSW 7 79752493 missense probably damaging 0.97
R5510:Wdr93 UTSW 7 79750031 missense probably damaging 1.00
R5625:Wdr93 UTSW 7 79771018 missense probably benign 0.00
R5648:Wdr93 UTSW 7 79777226 missense probably benign 0.04
R5950:Wdr93 UTSW 7 79773431 missense probably damaging 0.99
R6147:Wdr93 UTSW 7 79758497 missense probably benign
R6530:Wdr93 UTSW 7 79755993 missense probably damaging 1.00
R7056:Wdr93 UTSW 7 79749340 missense probably damaging 1.00
R7079:Wdr93 UTSW 7 79749292 missense probably damaging 1.00
R7309:Wdr93 UTSW 7 79773355 missense possibly damaging 0.86
R7397:Wdr93 UTSW 7 79766424 missense probably null 0.01
R7426:Wdr93 UTSW 7 79777307 critical splice donor site probably null
R7455:Wdr93 UTSW 7 79775519 missense probably benign 0.09
R7618:Wdr93 UTSW 7 79785726 missense probably benign 0.02
R8360:Wdr93 UTSW 7 79749226 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTCTTCTTGACAGCATATGGCTGAC -3'
(R):5'- TGACAAATGGCTCACACAGAAGTATGG -3'

Sequencing Primer
(F):5'- atttaggccatttacatttaatgctg -3'
(R):5'- GTGCTAATTCTGCCTAGCAATCAG -3'
Posted On2014-04-24