Incidental Mutation 'R1686:Fam135a'
ID189303
Institutional Source Beutler Lab
Gene Symbol Fam135a
Ensembl Gene ENSMUSG00000026153
Gene Namefamily with sequence similarity 135, member A
Synonyms4921533L14Rik
MMRRC Submission 039719-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1686 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location24011093-24100341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24029806 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 448 (S448A)
Ref Sequence ENSEMBL: ENSMUSP00000139633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027337] [ENSMUST00000185807] [ENSMUST00000186331] [ENSMUST00000186999] [ENSMUST00000187369] [ENSMUST00000187752] [ENSMUST00000188712]
Predicted Effect probably benign
Transcript: ENSMUST00000027337
AA Change: S661A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027337
Gene: ENSMUSG00000026153
AA Change: S661A

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
coiled coil region 270 295 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 1072 1085 N/A INTRINSIC
Blast:LRRNT 1139 1172 4e-6 BLAST
low complexity region 1173 1184 N/A INTRINSIC
Pfam:DUF676 1235 1431 9e-65 PFAM
Pfam:PGAP1 1237 1440 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185807
SMART Domains Protein: ENSMUSP00000140078
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
Blast:LRRNT 27 60 4e-7 BLAST
low complexity region 61 72 N/A INTRINSIC
Pfam:DUF676 104 161 2.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186331
SMART Domains Protein: ENSMUSP00000140947
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
low complexity region 172 185 N/A INTRINSIC
Blast:LRRNT 239 272 1e-6 BLAST
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186999
AA Change: S491A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000140198
Gene: ENSMUSG00000026153
AA Change: S491A

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 1.8e-15 PFAM
Pfam:DUF3657 338 395 7.3e-8 PFAM
low complexity region 672 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187369
AA Change: S465A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140766
Gene: ENSMUSG00000026153
AA Change: S465A

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 3e-15 PFAM
coiled coil region 270 295 N/A INTRINSIC
Pfam:DUF3657 312 369 1.2e-7 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Blast:LRRNT 943 976 4e-6 BLAST
low complexity region 977 988 N/A INTRINSIC
Pfam:DUF676 1039 1235 6.8e-62 PFAM
Pfam:PGAP1 1041 1259 8.1e-5 PFAM
Pfam:LCAT 1097 1203 2.3e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187619
Predicted Effect probably benign
Transcript: ENSMUST00000187752
AA Change: S448A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139633
Gene: ENSMUSG00000026153
AA Change: S448A

DomainStartEndE-ValueType
Pfam:DUF3657 68 130 3e-15 PFAM
Pfam:DUF3657 295 352 1.2e-7 PFAM
low complexity region 629 640 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Blast:LRRNT 926 959 4e-6 BLAST
low complexity region 960 971 N/A INTRINSIC
Pfam:DUF676 1022 1218 6.7e-62 PFAM
Pfam:PGAP1 1024 1242 8e-5 PFAM
Pfam:LCAT 1080 1186 2.2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188712
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 100% (85/85)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G A 10: 100,612,860 V400I probably damaging Het
Abcb1b A G 5: 8,798,782 N14S probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrg3 A G 8: 95,033,369 N72S probably benign Het
Akain1 T A 17: 69,439,532 F3I possibly damaging Het
Akr1c21 T C 13: 4,577,453 L182P probably damaging Het
Arhgap21 A T 2: 20,881,848 Y12N probably damaging Het
Aup1 A T 6: 83,055,245 H131L probably damaging Het
Bag6 A G 17: 35,144,952 T812A possibly damaging Het
BC005561 T A 5: 104,519,923 Y770* probably null Het
Bmp2k A G 5: 97,063,533 Y520C unknown Het
Calm4 T G 13: 3,838,302 V136G probably damaging Het
Catsper2 A G 2: 121,400,042 probably null Het
Cc2d2a A G 5: 43,739,371 T1537A possibly damaging Het
Cntn2 A T 1: 132,526,311 V319D possibly damaging Het
Cux1 G A 5: 136,275,381 R1314* probably null Het
Cxcl12 A G 6: 117,173,547 I79V probably damaging Het
Cyp2j6 T C 4: 96,523,777 D418G probably benign Het
Ddx28 G C 8: 106,010,558 D289E probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxo33 G T 12: 59,204,840 N30K possibly damaging Het
Fgf12 A C 16: 28,398,341 Y21D probably damaging Het
Galntl5 C T 5: 25,210,434 S288L probably benign Het
Gart G T 16: 91,625,349 A760D probably damaging Het
Gba2 A T 4: 43,573,869 probably benign Het
Gm10518 C A 1: 179,803,792 S139* probably null Het
Gm4781 A T 10: 100,396,975 noncoding transcript Het
Gm9790 A G 3: 85,915,849 noncoding transcript Het
Gmps G A 3: 63,985,654 G127R probably damaging Het
Golim4 A T 3: 75,895,136 V283E probably benign Het
Gprc5a A T 6: 135,078,920 I122F possibly damaging Het
Gzmc T C 14: 56,233,884 K67E probably benign Het
Hapln3 C A 7: 79,121,890 V84L probably benign Het
Hif3a T A 7: 17,044,864 N377Y possibly damaging Het
Ifi211 G A 1: 173,899,403 H392Y probably damaging Het
Iqgap3 T A 3: 88,108,356 probably benign Het
Itga10 T A 3: 96,651,825 F410Y probably damaging Het
Jup T C 11: 100,372,434 Y705C probably damaging Het
Khsrp C T 17: 57,025,597 A228T probably benign Het
Lmntd2 C T 7: 141,211,085 G445D probably damaging Het
Lyst T C 13: 13,634,705 V320A possibly damaging Het
Magel2 T A 7: 62,378,240 H297Q possibly damaging Het
Mbd6 T C 10: 127,287,417 E33G probably damaging Het
Mob3b A G 4: 34,985,910 probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a T C 1: 88,234,612 probably null Het
Mymk A T 2: 27,062,334 W174R probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nipal3 T C 4: 135,447,288 Y384C possibly damaging Het
Nt5c3b A G 11: 100,440,094 probably benign Het
Obox6 T A 7: 15,833,825 L232F probably damaging Het
Obscn A C 11: 59,106,287 probably benign Het
Olfr834 T C 9: 18,988,543 L185P probably damaging Het
Phkb A G 8: 86,021,649 I706V probably benign Het
Plcb2 A G 2: 118,715,687 probably benign Het
Plek2 T C 12: 78,894,410 D216G probably damaging Het
Plxnb2 T C 15: 89,162,462 Y855C probably damaging Het
Prkcz T C 4: 155,271,256 T227A probably damaging Het
Psma7 A T 2: 180,037,422 D184E probably benign Het
Rai14 T A 15: 10,592,196 L204F probably damaging Het
Ralgapa2 A G 2: 146,358,000 V1208A probably benign Het
Rapgef6 A G 11: 54,691,632 R67G possibly damaging Het
Ryr2 C T 13: 11,603,779 probably benign Het
Satb1 T C 17: 51,739,999 S763G probably benign Het
Sdk1 A T 5: 142,034,537 H690L probably benign Het
Sfrp5 A C 19: 42,201,704 V103G possibly damaging Het
Six6 A G 12: 72,941,677 E208G probably benign Het
Sspo A T 6: 48,460,400 H1364L probably benign Het
Stard9 A T 2: 120,699,492 T2077S probably benign Het
Tacr3 T C 3: 134,829,493 L74P probably damaging Het
Tep1 T C 14: 50,836,788 E1880G probably benign Het
Tgfb3 A T 12: 86,069,743 probably benign Het
Thap7 G A 16: 17,528,712 P136S probably damaging Het
Tmc2 T C 2: 130,256,116 V717A possibly damaging Het
Usp43 T A 11: 67,887,767 S446C probably damaging Het
Vwa3a C T 7: 120,780,148 S492L probably damaging Het
Wdhd1 T A 14: 47,256,215 N16I probably damaging Het
Wdr95 A T 5: 149,593,101 D327V probably damaging Het
Zfp128 T G 7: 12,890,636 Y310* probably null Het
Other mutations in Fam135a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Fam135a APN 1 24055898 missense probably damaging 1.00
IGL01993:Fam135a APN 1 24055911 missense probably damaging 0.99
IGL02172:Fam135a APN 1 24024780 critical splice donor site probably null
IGL02832:Fam135a APN 1 24028633 missense probably benign 0.00
IGL03075:Fam135a APN 1 24030906 splice site probably benign
IGL03197:Fam135a APN 1 24044182 missense probably damaging 1.00
IGL03214:Fam135a APN 1 24053276 missense probably damaging 1.00
IGL03355:Fam135a APN 1 24029168 missense possibly damaging 0.93
PIT4434001:Fam135a UTSW 1 24029195 missense probably benign
R0276:Fam135a UTSW 1 24067964 missense probably damaging 1.00
R1429:Fam135a UTSW 1 24044267 missense probably damaging 1.00
R1553:Fam135a UTSW 1 24021870 missense probably damaging 0.97
R1582:Fam135a UTSW 1 24029317 missense probably damaging 1.00
R1732:Fam135a UTSW 1 24026653 missense possibly damaging 0.71
R1859:Fam135a UTSW 1 24030225 missense probably damaging 1.00
R1954:Fam135a UTSW 1 24029602 missense probably damaging 1.00
R2266:Fam135a UTSW 1 24028797 missense probably benign 0.22
R2570:Fam135a UTSW 1 24021964 missense probably damaging 1.00
R3725:Fam135a UTSW 1 24057434 nonsense probably null
R3740:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3741:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3765:Fam135a UTSW 1 24055877 missense possibly damaging 0.95
R3792:Fam135a UTSW 1 24028311 missense probably benign 0.14
R3940:Fam135a UTSW 1 24057475 missense probably damaging 0.98
R3946:Fam135a UTSW 1 24030394 missense probably damaging 0.96
R4754:Fam135a UTSW 1 24028754 nonsense probably null
R4794:Fam135a UTSW 1 24029160 missense probably benign 0.36
R4887:Fam135a UTSW 1 24024253 nonsense probably null
R4891:Fam135a UTSW 1 24030328 missense probably benign 0.00
R4929:Fam135a UTSW 1 24030000 missense probably benign 0.16
R4999:Fam135a UTSW 1 24020677 missense possibly damaging 0.83
R5092:Fam135a UTSW 1 24028807 missense probably benign 0.11
R5205:Fam135a UTSW 1 24029511 missense probably benign 0.05
R5313:Fam135a UTSW 1 24028585 missense possibly damaging 0.89
R5579:Fam135a UTSW 1 24029727 missense possibly damaging 0.93
R5689:Fam135a UTSW 1 24029053 missense probably benign 0.22
R5863:Fam135a UTSW 1 24014782 missense possibly damaging 0.94
R5869:Fam135a UTSW 1 24029430 missense possibly damaging 0.53
R6128:Fam135a UTSW 1 24030740 critical splice donor site probably null
R6505:Fam135a UTSW 1 24014872 missense probably damaging 1.00
R6668:Fam135a UTSW 1 24028848 missense probably damaging 0.99
R6793:Fam135a UTSW 1 24067925 missense possibly damaging 0.69
R6857:Fam135a UTSW 1 24014789 missense probably damaging 0.99
R6931:Fam135a UTSW 1 24085487 start codon destroyed probably damaging 1.00
R6977:Fam135a UTSW 1 24054098 missense probably damaging 1.00
R7187:Fam135a UTSW 1 24044214 missense probably damaging 1.00
R7206:Fam135a UTSW 1 24030273 missense probably benign 0.14
R7305:Fam135a UTSW 1 24030858 missense probably damaging 1.00
R7313:Fam135a UTSW 1 24057392 missense probably damaging 0.98
R7420:Fam135a UTSW 1 24012486 missense possibly damaging 0.68
R7646:Fam135a UTSW 1 24028623 missense probably benign 0.06
R7661:Fam135a UTSW 1 24072762 splice site probably null
R7681:Fam135a UTSW 1 24067915 missense probably benign 0.03
R7748:Fam135a UTSW 1 24028969 missense probably benign 0.00
R7845:Fam135a UTSW 1 24029657 missense probably benign 0.27
R7849:Fam135a UTSW 1 24044250 missense probably damaging 1.00
R7914:Fam135a UTSW 1 24026679 missense probably damaging 1.00
R8314:Fam135a UTSW 1 24021921 missense possibly damaging 0.84
X0022:Fam135a UTSW 1 24030214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTGTAAAGCATCCCTTTCAAGTGG -3'
(R):5'- TGTCAGCTAACACAGACAGAAGTGAAC -3'

Sequencing Primer
(F):5'- TCTTGAAGCTCTGTCCAAGG -3'
(R):5'- AGCTCTTGAACTCTGGCAG -3'
Posted On2014-05-14