Incidental Mutation 'R6857:Fam135a'
ID535292
Institutional Source Beutler Lab
Gene Symbol Fam135a
Ensembl Gene ENSMUSG00000026153
Gene Namefamily with sequence similarity 135, member A
Synonyms4921533L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R6857 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location24011093-24100341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 24014789 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1222 (D1222E)
Ref Sequence ENSEMBL: ENSMUSP00000139633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027337] [ENSMUST00000186331] [ENSMUST00000187369] [ENSMUST00000187752] [ENSMUST00000188712]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027337
AA Change: D1435E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027337
Gene: ENSMUSG00000026153
AA Change: D1435E

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
coiled coil region 270 295 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 1072 1085 N/A INTRINSIC
Blast:LRRNT 1139 1172 4e-6 BLAST
low complexity region 1173 1184 N/A INTRINSIC
Pfam:DUF676 1235 1431 9e-65 PFAM
Pfam:PGAP1 1237 1440 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186331
SMART Domains Protein: ENSMUSP00000140947
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
low complexity region 172 185 N/A INTRINSIC
Blast:LRRNT 239 272 1e-6 BLAST
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187369
AA Change: D1239E

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140766
Gene: ENSMUSG00000026153
AA Change: D1239E

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 3e-15 PFAM
coiled coil region 270 295 N/A INTRINSIC
Pfam:DUF3657 312 369 1.2e-7 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Blast:LRRNT 943 976 4e-6 BLAST
low complexity region 977 988 N/A INTRINSIC
Pfam:DUF676 1039 1235 6.8e-62 PFAM
Pfam:PGAP1 1041 1259 8.1e-5 PFAM
Pfam:LCAT 1097 1203 2.3e-4 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000187752
AA Change: D1222E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139633
Gene: ENSMUSG00000026153
AA Change: D1222E

DomainStartEndE-ValueType
Pfam:DUF3657 68 130 3e-15 PFAM
Pfam:DUF3657 295 352 1.2e-7 PFAM
low complexity region 629 640 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Blast:LRRNT 926 959 4e-6 BLAST
low complexity region 960 971 N/A INTRINSIC
Pfam:DUF676 1022 1218 6.7e-62 PFAM
Pfam:PGAP1 1024 1242 8e-5 PFAM
Pfam:LCAT 1080 1186 2.2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188712
Meta Mutation Damage Score 0.3102 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A T 13: 66,432,102 H107Q probably benign Het
Abca6 A G 11: 110,219,688 L545P possibly damaging Het
Adam4 T C 12: 81,419,949 T633A possibly damaging Het
Ahnak C T 19: 9,037,168 Q119* probably null Het
AI314180 T A 4: 58,814,065 D1347V probably damaging Het
Anxa10 C A 8: 62,061,017 A239S probably benign Het
B020011L13Rik A T 1: 117,801,288 H175L probably benign Het
BC067074 A T 13: 113,319,958 N846I probably damaging Het
Best2 A G 8: 85,007,823 V422A probably benign Het
Cc2d2b T C 19: 40,770,865 F298S possibly damaging Het
Cd38 T A 5: 43,906,198 M211K probably damaging Het
Cd3d T G 9: 44,985,604 M92R probably damaging Het
Cdk5rap2 C A 4: 70,245,396 E1474* probably null Het
Clvs1 A G 4: 9,449,433 K341E probably benign Het
Copg2 G T 6: 30,863,598 D112E possibly damaging Het
Dmxl1 A T 18: 49,864,835 N697Y probably damaging Het
Dync1h1 T C 12: 110,658,547 S3803P possibly damaging Het
Epx T A 11: 87,869,955 K384* probably null Het
Fndc1 T A 17: 7,772,170 H898L unknown Het
Gapvd1 A G 2: 34,728,377 I190T probably damaging Het
Gm14139 G T 2: 150,192,062 C132F probably damaging Het
Hax1 T G 3: 89,997,452 S122R probably damaging Het
Hdac9 T G 12: 34,393,363 M272L probably benign Het
Itgb7 T C 15: 102,223,465 S228G probably damaging Het
Itpr2 C A 6: 146,397,019 E315* probably null Het
Kctd8 T C 5: 69,296,702 N331D probably benign Het
Ky G A 9: 102,542,432 G546E probably damaging Het
Lao1 T C 4: 118,963,826 probably null Het
Mtmr12 T A 15: 12,263,832 W427R probably damaging Het
Mxra8 A G 4: 155,843,136 K434E possibly damaging Het
Myh4 T C 11: 67,249,885 C676R possibly damaging Het
Nek7 C T 1: 138,515,682 G178R probably damaging Het
Olfr1082 A T 2: 86,594,264 L188H probably damaging Het
Olfr1141 A T 2: 87,753,487 C169S probably damaging Het
Olfr914 T C 9: 38,607,011 L182P probably benign Het
Paqr5 G T 9: 61,976,088 H41N probably damaging Het
Plekha8 T C 6: 54,629,935 L405P probably damaging Het
Plpbp A G 8: 27,045,426 N79S possibly damaging Het
Plxnd1 G T 6: 115,993,763 A348E probably benign Het
Prdm9 T C 17: 15,544,256 Q754R probably benign Het
Pygm G T 19: 6,393,757 G583C probably damaging Het
Rgs12 A T 5: 35,030,022 K213* probably null Het
Serpina3m T C 12: 104,389,326 L84P probably damaging Het
Tab2 T C 10: 7,920,413 T102A possibly damaging Het
Tagln3 G T 16: 45,724,236 A24E probably benign Het
Tanc2 A G 11: 105,910,288 E1110G possibly damaging Het
Tcf3 T C 10: 80,416,899 probably null Het
Tmem14a T C 1: 21,229,545 probably benign Het
Ttn T A 2: 76,917,931 E4258V possibly damaging Het
Ubr4 G A 4: 139,486,051 D5104N possibly damaging Het
Ugt2b37 C G 5: 87,240,846 A503P probably damaging Het
Unc45b A G 11: 82,913,212 I72V probably benign Het
Vmn1r88 A T 7: 13,178,331 M205L possibly damaging Het
Vmn2r109 C T 17: 20,540,670 M808I probably benign Het
Wdr72 G T 9: 74,155,041 V490L probably damaging Het
Zgrf1 T A 3: 127,581,447 V785E probably damaging Het
Zswim7 A T 11: 62,281,129 probably benign Het
Other mutations in Fam135a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Fam135a APN 1 24055898 missense probably damaging 1.00
IGL01993:Fam135a APN 1 24055911 missense probably damaging 0.99
IGL02172:Fam135a APN 1 24024780 critical splice donor site probably null
IGL02832:Fam135a APN 1 24028633 missense probably benign 0.00
IGL03075:Fam135a APN 1 24030906 splice site probably benign
IGL03197:Fam135a APN 1 24044182 missense probably damaging 1.00
IGL03214:Fam135a APN 1 24053276 missense probably damaging 1.00
IGL03355:Fam135a APN 1 24029168 missense possibly damaging 0.93
PIT4434001:Fam135a UTSW 1 24029195 missense probably benign
R0276:Fam135a UTSW 1 24067964 missense probably damaging 1.00
R1429:Fam135a UTSW 1 24044267 missense probably damaging 1.00
R1553:Fam135a UTSW 1 24021870 missense probably damaging 0.97
R1582:Fam135a UTSW 1 24029317 missense probably damaging 1.00
R1686:Fam135a UTSW 1 24029806 missense probably benign 0.05
R1732:Fam135a UTSW 1 24026653 missense possibly damaging 0.71
R1859:Fam135a UTSW 1 24030225 missense probably damaging 1.00
R1954:Fam135a UTSW 1 24029602 missense probably damaging 1.00
R2266:Fam135a UTSW 1 24028797 missense probably benign 0.22
R2570:Fam135a UTSW 1 24021964 missense probably damaging 1.00
R3725:Fam135a UTSW 1 24057434 nonsense probably null
R3740:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3741:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3765:Fam135a UTSW 1 24055877 missense possibly damaging 0.95
R3792:Fam135a UTSW 1 24028311 missense probably benign 0.14
R3940:Fam135a UTSW 1 24057475 missense probably damaging 0.98
R3946:Fam135a UTSW 1 24030394 missense probably damaging 0.96
R4754:Fam135a UTSW 1 24028754 nonsense probably null
R4794:Fam135a UTSW 1 24029160 missense probably benign 0.36
R4887:Fam135a UTSW 1 24024253 nonsense probably null
R4891:Fam135a UTSW 1 24030328 missense probably benign 0.00
R4929:Fam135a UTSW 1 24030000 missense probably benign 0.16
R4999:Fam135a UTSW 1 24020677 missense possibly damaging 0.83
R5092:Fam135a UTSW 1 24028807 missense probably benign 0.11
R5205:Fam135a UTSW 1 24029511 missense probably benign 0.05
R5313:Fam135a UTSW 1 24028585 missense possibly damaging 0.89
R5579:Fam135a UTSW 1 24029727 missense possibly damaging 0.93
R5689:Fam135a UTSW 1 24029053 missense probably benign 0.22
R5863:Fam135a UTSW 1 24014782 missense possibly damaging 0.94
R5869:Fam135a UTSW 1 24029430 missense possibly damaging 0.53
R6128:Fam135a UTSW 1 24030740 critical splice donor site probably null
R6505:Fam135a UTSW 1 24014872 missense probably damaging 1.00
R6668:Fam135a UTSW 1 24028848 missense probably damaging 0.99
R6793:Fam135a UTSW 1 24067925 missense possibly damaging 0.69
R6931:Fam135a UTSW 1 24085487 start codon destroyed probably damaging 1.00
R6977:Fam135a UTSW 1 24054098 missense probably damaging 1.00
R7187:Fam135a UTSW 1 24044214 missense probably damaging 1.00
R7206:Fam135a UTSW 1 24030273 missense probably benign 0.14
R7305:Fam135a UTSW 1 24030858 missense probably damaging 1.00
R7313:Fam135a UTSW 1 24057392 missense probably damaging 0.98
R7420:Fam135a UTSW 1 24012486 missense possibly damaging 0.68
R7646:Fam135a UTSW 1 24028623 missense probably benign 0.06
R7661:Fam135a UTSW 1 24072762 intron probably null
R7681:Fam135a UTSW 1 24067915 missense probably benign 0.03
R7748:Fam135a UTSW 1 24028969 missense probably benign 0.00
R7845:Fam135a UTSW 1 24029657 missense probably benign 0.27
R7849:Fam135a UTSW 1 24044250 missense probably damaging 1.00
R7914:Fam135a UTSW 1 24026679 missense probably damaging 1.00
R8314:Fam135a UTSW 1 24021921 missense possibly damaging 0.84
X0022:Fam135a UTSW 1 24030214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACAGCTCACATATCAGGAGGG -3'
(R):5'- GATTTCTCCTAGATTGCAGATTGC -3'

Sequencing Primer
(F):5'- CTCACATATCAGGAGGGGAAACTG -3'
(R):5'- CAGATTGCATACATTGAAACAGGC -3'
Posted On2018-09-12