Incidental Mutation 'R1723:Aoc3'
ID191624
Institutional Source Beutler Lab
Gene Symbol Aoc3
Ensembl Gene ENSMUSG00000019326
Gene Nameamine oxidase, copper containing 3
Synonymssemicarbazide-sensitive amine oxidase, SSAO, VAP1
MMRRC Submission 039755-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1723 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101330605-101341938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101336435 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 378 (V378E)
Ref Sequence ENSEMBL: ENSMUSP00000017316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017316] [ENSMUST00000103105]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017316
AA Change: V378E

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000017316
Gene: ENSMUSG00000019326
AA Change: V378E

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 23 109 4.3e-24 PFAM
Pfam:Cu_amine_oxidN3 126 226 1.4e-28 PFAM
Pfam:Cu_amine_oxid 251 444 4.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103105
AA Change: V658E

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099394
Gene: ENSMUSG00000019326
AA Change: V658E

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 169 269 1.5e-31 PFAM
low complexity region 284 298 N/A INTRINSIC
Pfam:Cu_amine_oxid 314 721 5.3e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187880
Meta Mutation Damage Score 0.9317 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice display decreased lymphocyte migration and homing in response to inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 G T 6: 85,628,753 G2462C probably damaging Het
Anapc5 T C 5: 122,799,343 E464G probably damaging Het
Atp13a5 T A 16: 29,232,799 K1152I possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC027072 A T 17: 71,750,378 F768Y probably damaging Het
Calcoco1 C A 15: 102,719,553 G49C probably damaging Het
Cbwd1 A G 19: 24,948,094 V166A possibly damaging Het
Cd70 T C 17: 57,146,401 T88A possibly damaging Het
Cpeb1 C T 7: 81,436,226 R56Q probably benign Het
Dglucy A G 12: 100,842,679 Y212C probably damaging Het
Dnhd1 C A 7: 105,714,920 P4160T possibly damaging Het
Ecel1 T C 1: 87,154,421 D190G probably benign Het
Exoc6b A G 6: 85,069,344 L21P probably damaging Het
Fam110c A G 12: 31,074,395 R119G unknown Het
Fam198b T A 3: 79,936,663 N32K probably benign Het
Gm42791 C A 5: 148,959,501 probably benign Het
Hpcal4 A G 4: 123,190,739 I154V probably benign Het
Itgb1 A G 8: 128,726,038 D728G probably damaging Het
Kdm5d A T Y: 927,753 D701V probably damaging Het
Kif18a A G 2: 109,302,882 K448E probably damaging Het
Kif26a T C 12: 112,173,858 F507S possibly damaging Het
Kmt2c C T 5: 25,315,005 G2036R probably damaging Het
Lrrc43 T A 5: 123,492,213 probably benign Het
Map3k20 T C 2: 72,389,492 I256T probably damaging Het
Med29 T A 7: 28,392,705 probably benign Het
Mob3b A G 4: 34,954,026 C215R probably damaging Het
Mtf2 T C 5: 108,088,070 Y87H probably damaging Het
Myo18a G A 11: 77,853,314 R1834K probably damaging Het
Nlrc4 T A 17: 74,441,908 D779V probably damaging Het
Olfr638 T C 7: 104,003,311 F18S probably damaging Het
Otud3 T C 4: 138,898,018 T242A probably damaging Het
Pnliprp1 T A 19: 58,732,142 M150K possibly damaging Het
Polm T A 11: 5,834,776 Q227L probably benign Het
Poln A G 5: 34,122,672 V282A probably benign Het
Ppfia2 T A 10: 106,915,672 probably null Het
Rad51 T G 2: 119,123,814 M168R probably benign Het
Senp2 A G 16: 22,028,042 T266A probably benign Het
Sfswap A G 5: 129,539,694 T401A probably benign Het
Slc35a4 C A 18: 36,682,735 T206K possibly damaging Het
Slc40a1 A G 1: 45,924,761 S23P probably damaging Het
Spef2 T C 15: 9,614,209 K1217R probably damaging Het
St18 A C 1: 6,810,685 probably benign Het
Tdrd6 T C 17: 43,628,327 D610G possibly damaging Het
Tmem163 C A 1: 127,551,371 R137L probably damaging Het
Tmem94 T A 11: 115,794,748 D942E probably damaging Het
Ttn T A 2: 76,750,410 I23380F possibly damaging Het
Uckl1 T A 2: 181,570,600 probably null Het
Vav2 T C 2: 27,318,964 D99G possibly damaging Het
Vmn2r30 T A 7: 7,334,260 I126F probably benign Het
Zbtb41 A T 1: 139,423,563 Q138L probably benign Het
Zfp599 T C 9: 22,258,065 Y37C probably damaging Het
Zfp784 T A 7: 5,035,783 T259S possibly damaging Het
Zfp954 T C 7: 7,115,838 S236G probably benign Het
Other mutations in Aoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Aoc3 APN 11 101337478 missense possibly damaging 0.73
IGL02026:Aoc3 APN 11 101337595 missense probably benign
IGL02500:Aoc3 APN 11 101337389 nonsense probably null
R0463:Aoc3 UTSW 11 101331606 missense probably damaging 1.00
R0524:Aoc3 UTSW 11 101337511 missense probably damaging 1.00
R0538:Aoc3 UTSW 11 101332138 missense possibly damaging 0.77
R0685:Aoc3 UTSW 11 101336447 missense possibly damaging 0.84
R0740:Aoc3 UTSW 11 101332332 missense probably benign 0.01
R0946:Aoc3 UTSW 11 101332305 missense possibly damaging 0.89
R1869:Aoc3 UTSW 11 101331467 nonsense probably null
R3735:Aoc3 UTSW 11 101332219 missense probably damaging 0.99
R4497:Aoc3 UTSW 11 101332045 missense possibly damaging 0.70
R4613:Aoc3 UTSW 11 101337659 intron probably benign
R4858:Aoc3 UTSW 11 101331662 missense probably damaging 1.00
R4954:Aoc3 UTSW 11 101332099 missense probably damaging 1.00
R4976:Aoc3 UTSW 11 101330974 missense probably damaging 1.00
R5770:Aoc3 UTSW 11 101331752 nonsense probably null
R6679:Aoc3 UTSW 11 101331453 missense probably damaging 1.00
R7485:Aoc3 UTSW 11 101337403 missense probably damaging 1.00
R7693:Aoc3 UTSW 11 101332512 missense probably benign 0.00
R7888:Aoc3 UTSW 11 101332497 missense probably damaging 1.00
R8041:Aoc3 UTSW 11 101332306 missense probably benign 0.00
R8444:Aoc3 UTSW 11 101341747 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGAGCATTTAGCCTGCTTCCATC -3'
(R):5'- TAGAACACTGGTTCCCAGCCCAAG -3'

Sequencing Primer
(F):5'- TTCCATCATGCAGCTTAGAGAC -3'
(R):5'- atggttggggggggtgg -3'
Posted On2014-05-14