Incidental Mutation 'R1731:Slc8b1'
ID199304
Institutional Source Beutler Lab
Gene Symbol Slc8b1
Ensembl Gene ENSMUSG00000032754
Gene Namesolute carrier family 8 (sodium/lithium/calcium exchanger), member B1
SynonymsNCLX, NCKX6, Slc24a6
MMRRC Submission 039763-MU
Accession Numbers

Ncbi RefSeq: NM_133221.2, NM_001177594.1, NM_001177595.1; MGI:2180781

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1731 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120511168-120534024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120521115 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 208 (I208T)
Ref Sequence ENSEMBL: ENSMUSP00000107521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068326] [ENSMUST00000076051] [ENSMUST00000111889] [ENSMUST00000111890] [ENSMUST00000140329]
Predicted Effect probably benign
Transcript: ENSMUST00000068326
AA Change: I225T

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000064714
Gene: ENSMUSG00000032754
AA Change: I225T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 103 246 5.7e-25 PFAM
low complexity region 262 275 N/A INTRINSIC
low complexity region 337 351 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Pfam:Na_Ca_ex 421 574 1.8e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076051
AA Change: I225T

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075428
Gene: ENSMUSG00000032754
AA Change: I225T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 113 244 9.2e-19 PFAM
low complexity region 262 275 N/A INTRINSIC
transmembrane domain 323 345 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Pfam:Na_Ca_ex 431 477 2.3e-8 PFAM
low complexity region 507 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111889
SMART Domains Protein: ENSMUSP00000107520
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 113 232 2.5e-16 PFAM
low complexity region 281 295 N/A INTRINSIC
transmembrane domain 304 326 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
Pfam:Na_Ca_ex 375 516 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111890
AA Change: I208T

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107521
Gene: ENSMUSG00000032754
AA Change: I208T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 116 227 2.8e-12 PFAM
low complexity region 245 258 N/A INTRINSIC
low complexity region 320 334 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 370 392 N/A INTRINSIC
Pfam:Na_Ca_ex 414 555 3.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123326
Predicted Effect probably benign
Transcript: ENSMUST00000140329
SMART Domains Protein: ENSMUSP00000117260
Gene: ENSMUSG00000032754

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC24A6 belongs to a family of potassium-dependent sodium/calcium exchangers that maintain cellular calcium homeostasis through the electrogenic countertransport of 4 sodium ions for 1 calcium ion and 1 potassium ion (Cai and Lytton, 2004 [PubMed 14625281]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(22) : Targeted(3) Gene trapped(19)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,525,356 Y140F probably damaging Het
Adgrl4 T G 3: 151,540,986 I641S possibly damaging Het
Aqp9 A G 9: 71,122,968 I205T possibly damaging Het
Arap3 C T 18: 37,989,912 V512I probably benign Het
Atf2 C T 2: 73,845,509 G123E probably damaging Het
Baz1a T C 12: 54,918,545 D708G possibly damaging Het
Calcrl A G 2: 84,345,168 probably null Het
Capzb T A 4: 139,280,030 W110R probably damaging Het
Casp8ap2 A T 4: 32,641,442 N832I possibly damaging Het
Cecr2 T A 6: 120,758,180 H764Q possibly damaging Het
Cep131 T C 11: 120,076,916 probably null Het
Ces2e T C 8: 104,929,576 V173A probably damaging Het
Clstn3 T C 6: 124,431,632 D944G probably benign Het
Cyb5rl C A 4: 107,080,913 A189E probably damaging Het
Cyp2c40 A G 19: 39,812,689 S41P probably damaging Het
D3Ertd254e T A 3: 36,164,471 F214L probably benign Het
Dscam A G 16: 96,819,876 L544P probably damaging Het
Epha2 A G 4: 141,321,752 K640E possibly damaging Het
Erap1 T A 13: 74,666,122 C8* probably null Het
Fat3 A G 9: 15,995,937 V2923A probably benign Het
Fat4 A T 3: 38,891,310 I1451F probably damaging Het
Fuk A T 8: 110,894,823 I163N probably damaging Het
Fzd6 G A 15: 39,031,327 G296D probably damaging Het
Gm3486 T A 14: 41,484,535 M194L probably benign Het
Gm5592 C T 7: 41,288,413 A373V probably damaging Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Hectd3 T A 4: 116,996,455 probably null Het
Hira T A 16: 18,933,014 V521E probably benign Het
Hsd17b6 A G 10: 127,994,479 L141S possibly damaging Het
Idua A G 5: 108,681,672 D467G probably benign Het
Ikzf4 G A 10: 128,634,532 P373L probably benign Het
Kcng1 T C 2: 168,268,689 E185G probably benign Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lpcat4 T C 2: 112,243,843 L250P probably damaging Het
Lrrc49 A G 9: 60,621,631 Y281H probably damaging Het
Mta2 C A 19: 8,947,724 probably null Het
Myo15b T C 11: 115,891,560 I372T possibly damaging Het
Myocd T A 11: 65,200,888 N76I probably benign Het
Nav2 T A 7: 49,548,174 Y1123N probably damaging Het
Otogl A T 10: 107,817,111 C1127S probably damaging Het
Pcdhb8 A G 18: 37,355,838 K190E probably damaging Het
Pcnx A G 12: 81,990,704 H1918R probably damaging Het
Pde2a T A 7: 101,501,660 Y272N probably damaging Het
Phldb3 T C 7: 24,619,235 V313A probably benign Het
Plch2 C T 4: 155,006,994 V116I possibly damaging Het
Plod2 G A 9: 92,584,604 probably null Het
Ppfibp2 T C 7: 107,740,589 Y730H probably damaging Het
Ptprh T C 7: 4,601,913 E44G probably benign Het
Rab11fip1 T C 8: 27,152,410 E787G probably damaging Het
Rabep2 T A 7: 126,444,272 L448Q probably damaging Het
Rbfox3 A G 11: 118,496,936 probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf125 A G 18: 20,977,816 T44A probably benign Het
Rusc2 G T 4: 43,426,046 A1384S probably benign Het
Selp T A 1: 164,141,440 C536* probably null Het
Serpinb3c G A 1: 107,271,774 T339I probably damaging Het
Slc4a5 C T 6: 83,296,635 R986C probably damaging Het
Sp3 G A 2: 72,946,655 H533Y probably damaging Het
Tiam2 A G 17: 3,518,423 R1615G probably damaging Het
Tie1 T C 4: 118,476,263 E802G probably damaging Het
Tinagl1 A G 4: 130,168,049 V164A probably benign Het
Vmn1r68 A G 7: 10,527,875 Y99H probably damaging Het
Vmn1r87 T A 7: 13,131,776 T195S possibly damaging Het
Vmn2r56 T C 7: 12,733,045 T21A probably benign Het
Zfp108 C A 7: 24,258,539 H34Q possibly damaging Het
Zfp456 C T 13: 67,366,555 S344N probably benign Het
Zscan22 T C 7: 12,906,980 C384R probably damaging Het
Other mutations in Slc8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Slc8b1 APN 5 120532984 missense probably damaging 1.00
IGL01111:Slc8b1 APN 5 120532935 missense probably damaging 1.00
IGL02186:Slc8b1 APN 5 120527863 critical splice donor site probably null
IGL02448:Slc8b1 APN 5 120525791 missense probably damaging 1.00
IGL02501:Slc8b1 APN 5 120520853 missense probably damaging 1.00
IGL03380:Slc8b1 APN 5 120519735 missense probably damaging 1.00
R0062:Slc8b1 UTSW 5 120521863 critical splice donor site probably null
R0062:Slc8b1 UTSW 5 120521863 critical splice donor site probably null
R0082:Slc8b1 UTSW 5 120524200 unclassified probably benign
R0532:Slc8b1 UTSW 5 120519671 missense probably damaging 0.99
R0550:Slc8b1 UTSW 5 120531155 splice site probably benign
R0751:Slc8b1 UTSW 5 120524195 unclassified probably benign
R1667:Slc8b1 UTSW 5 120521082 missense probably benign 0.39
R1710:Slc8b1 UTSW 5 120519652 missense probably damaging 1.00
R1865:Slc8b1 UTSW 5 120529652 missense probably damaging 1.00
R2829:Slc8b1 UTSW 5 120524013 missense probably benign 0.22
R4544:Slc8b1 UTSW 5 120531153 splice site probably null
R4553:Slc8b1 UTSW 5 120529598 missense probably damaging 0.98
R4976:Slc8b1 UTSW 5 120525675 nonsense probably null
R4977:Slc8b1 UTSW 5 120524287 missense possibly damaging 0.51
R5690:Slc8b1 UTSW 5 120513205 nonsense probably null
R5812:Slc8b1 UTSW 5 120513338 splice site probably null
R6030:Slc8b1 UTSW 5 120519920 critical splice donor site probably null
R6030:Slc8b1 UTSW 5 120519920 critical splice donor site probably null
R6107:Slc8b1 UTSW 5 120529600 missense probably damaging 0.99
R6411:Slc8b1 UTSW 5 120521126 missense probably damaging 0.99
R6486:Slc8b1 UTSW 5 120533002 missense probably damaging 1.00
R6542:Slc8b1 UTSW 5 120529517 missense probably damaging 1.00
R6550:Slc8b1 UTSW 5 120524017 missense probably damaging 1.00
R6992:Slc8b1 UTSW 5 120527815 missense probably damaging 0.98
R7672:Slc8b1 UTSW 5 120533035 missense probably damaging 0.99
R8056:Slc8b1 UTSW 5 120520617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTTTAGTGGCTTTCTCAGACCC -3'
(R):5'- TTGACCCAGTTTTCTGTGAGGCCC -3'

Sequencing Primer
(F):5'- TCCCCAAATGTATGGAGACG -3'
(R):5'- TGGGCTCCTGATCACATCTAAAAG -3'
Posted On2014-05-23