Incidental Mutation 'R5690:Slc8b1'
ID443620
Institutional Source Beutler Lab
Gene Symbol Slc8b1
Ensembl Gene ENSMUSG00000032754
Gene Namesolute carrier family 8 (sodium/lithium/calcium exchanger), member B1
SynonymsNCLX, NCKX6, Slc24a6
MMRRC Submission 043323-MU
Accession Numbers

Ncbi RefSeq: NM_133221.2, NM_001177594.1, NM_001177595.1; MGI:2180781

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5690 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120511168-120534024 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 120513205 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 10 (W10*)
Ref Sequence ENSEMBL: ENSMUSP00000117260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068326] [ENSMUST00000076051] [ENSMUST00000111889] [ENSMUST00000111890] [ENSMUST00000140329] [ENSMUST00000147496]
Predicted Effect probably null
Transcript: ENSMUST00000068326
AA Change: W10*
SMART Domains Protein: ENSMUSP00000064714
Gene: ENSMUSG00000032754
AA Change: W10*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 103 246 5.7e-25 PFAM
low complexity region 262 275 N/A INTRINSIC
low complexity region 337 351 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Pfam:Na_Ca_ex 421 574 1.8e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076051
AA Change: W10*
SMART Domains Protein: ENSMUSP00000075428
Gene: ENSMUSG00000032754
AA Change: W10*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 113 244 9.2e-19 PFAM
low complexity region 262 275 N/A INTRINSIC
transmembrane domain 323 345 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Pfam:Na_Ca_ex 431 477 2.3e-8 PFAM
low complexity region 507 519 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111889
AA Change: W10*
SMART Domains Protein: ENSMUSP00000107520
Gene: ENSMUSG00000032754
AA Change: W10*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 113 232 2.5e-16 PFAM
low complexity region 281 295 N/A INTRINSIC
transmembrane domain 304 326 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
Pfam:Na_Ca_ex 375 516 1.7e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111890
AA Change: W10*
SMART Domains Protein: ENSMUSP00000107521
Gene: ENSMUSG00000032754
AA Change: W10*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Na_Ca_ex 116 227 2.8e-12 PFAM
low complexity region 245 258 N/A INTRINSIC
low complexity region 320 334 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 370 392 N/A INTRINSIC
Pfam:Na_Ca_ex 414 555 3.2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140329
AA Change: W10*
SMART Domains Protein: ENSMUSP00000117260
Gene: ENSMUSG00000032754
AA Change: W10*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147496
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC24A6 belongs to a family of potassium-dependent sodium/calcium exchangers that maintain cellular calcium homeostasis through the electrogenic countertransport of 4 sodium ions for 1 calcium ion and 1 potassium ion (Cai and Lytton, 2004 [PubMed 14625281]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(22) : Targeted(3) Gene trapped(19)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik G A 2: 156,865,314 V58I probably benign Het
2810474O19Rik T C 6: 149,328,237 L927S possibly damaging Het
4930533K18Rik A G 10: 70,923,314 probably benign Het
Acadl T C 1: 66,853,286 Y126C probably damaging Het
Ak6 A G 13: 100,655,621 probably null Het
Ap1s1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 5: 137,037,379 probably benign Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp6v1e1 A T 6: 120,808,356 probably null Het
Axin1 A G 17: 26,194,937 Y792C probably damaging Het
C1s2 T C 6: 124,631,037 N233S probably benign Het
Ccer2 C A 7: 28,756,204 probably benign Het
Cfap46 A G 7: 139,638,353 S1481P probably benign Het
Cspg4 A T 9: 56,898,735 T2277S probably benign Het
Ctsl T A 13: 64,365,208 N300I probably damaging Het
Dnah2 T C 11: 69,491,544 I1247V probably benign Het
Dsg3 A T 18: 20,522,051 Q135L probably benign Het
Efcab14 G A 4: 115,760,047 V318M possibly damaging Het
Etl4 G A 2: 20,805,836 S910N probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Frmd4b T C 6: 97,353,203 E133G possibly damaging Het
Herc2 T C 7: 56,157,705 F2514S probably benign Het
Il18rap A G 1: 40,537,112 D261G possibly damaging Het
Klk1b16 A G 7: 44,140,894 probably null Het
Lrp1b A C 2: 40,750,894 probably null Het
Mrpl45 C A 11: 97,321,586 probably benign Het
Myh13 A G 11: 67,329,275 E150G probably damaging Het
Nbas T A 12: 13,336,284 V737D probably damaging Het
Ncr1 T C 7: 4,338,297 Y59H probably damaging Het
Nt5c1a T A 4: 123,215,939 V277E probably damaging Het
Ogfod1 T A 8: 94,058,141 S343T probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pnpla1 A T 17: 28,878,372 I171F probably damaging Het
Rdh8 A G 9: 20,825,489 N259S probably damaging Het
Slc22a12 A G 19: 6,536,848 M496T probably benign Het
Smarcc2 G A 10: 128,484,407 G887S probably damaging Het
Smc1b A G 15: 85,112,773 S549P probably damaging Het
Synj2 A G 17: 6,035,527 M1181V probably benign Het
Tbx15 T C 3: 99,308,850 S76P probably damaging Het
Tbx2 A T 11: 85,837,053 I271F probably damaging Het
Thap4 A G 1: 93,716,630 probably null Het
Tmc2 A G 2: 130,232,386 Y333C probably damaging Het
Trcg1 C T 9: 57,241,811 P222L probably benign Het
Tubb3 T C 8: 123,421,306 V326A probably benign Het
Unc80 A C 1: 66,640,572 I2101L probably benign Het
Vmn1r19 T C 6: 57,404,795 L111S probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Xpo4 T C 14: 57,590,989 I805V probably benign Het
Other mutations in Slc8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Slc8b1 APN 5 120532984 missense probably damaging 1.00
IGL01111:Slc8b1 APN 5 120532935 missense probably damaging 1.00
IGL02186:Slc8b1 APN 5 120527863 critical splice donor site probably null
IGL02448:Slc8b1 APN 5 120525791 missense probably damaging 1.00
IGL02501:Slc8b1 APN 5 120520853 missense probably damaging 1.00
IGL03380:Slc8b1 APN 5 120519735 missense probably damaging 1.00
R0062:Slc8b1 UTSW 5 120521863 critical splice donor site probably null
R0062:Slc8b1 UTSW 5 120521863 critical splice donor site probably null
R0082:Slc8b1 UTSW 5 120524200 unclassified probably benign
R0532:Slc8b1 UTSW 5 120519671 missense probably damaging 0.99
R0550:Slc8b1 UTSW 5 120531155 splice site probably benign
R0751:Slc8b1 UTSW 5 120524195 unclassified probably benign
R1667:Slc8b1 UTSW 5 120521082 missense probably benign 0.39
R1710:Slc8b1 UTSW 5 120519652 missense probably damaging 1.00
R1731:Slc8b1 UTSW 5 120521115 missense probably benign 0.12
R1865:Slc8b1 UTSW 5 120529652 missense probably damaging 1.00
R2829:Slc8b1 UTSW 5 120524013 missense probably benign 0.22
R4544:Slc8b1 UTSW 5 120531153 splice site probably null
R4553:Slc8b1 UTSW 5 120529598 missense probably damaging 0.98
R4976:Slc8b1 UTSW 5 120525675 nonsense probably null
R4977:Slc8b1 UTSW 5 120524287 missense possibly damaging 0.51
R5812:Slc8b1 UTSW 5 120513338 splice site probably null
R6030:Slc8b1 UTSW 5 120519920 critical splice donor site probably null
R6030:Slc8b1 UTSW 5 120519920 critical splice donor site probably null
R6107:Slc8b1 UTSW 5 120529600 missense probably damaging 0.99
R6411:Slc8b1 UTSW 5 120521126 missense probably damaging 0.99
R6486:Slc8b1 UTSW 5 120533002 missense probably damaging 1.00
R6542:Slc8b1 UTSW 5 120529517 missense probably damaging 1.00
R6550:Slc8b1 UTSW 5 120524017 missense probably damaging 1.00
R6992:Slc8b1 UTSW 5 120527815 missense probably damaging 0.98
R7672:Slc8b1 UTSW 5 120533035 missense probably damaging 0.99
R8056:Slc8b1 UTSW 5 120520617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGGCTTAGCTGGGAAAG -3'
(R):5'- TCTGAGGATTCCTGTAGATCCCAG -3'

Sequencing Primer
(F):5'- GCTTAGCTGGGAAAGGTCTC -3'
(R):5'- AGATCCCAGGGTTGTAATGATTAGC -3'
Posted On2016-11-09