Incidental Mutation 'R1738:Csde1'
ID199842
Institutional Source Beutler Lab
Gene Symbol Csde1
Ensembl Gene ENSMUSG00000068823
Gene Namecold shock domain containing E1, RNA binding
Synonymsunr, D3Jfr1
MMRRC Submission 039770-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R1738 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103020426-103058186 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 103029177 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029446] [ENSMUST00000197488] [ENSMUST00000197827] [ENSMUST00000198180] [ENSMUST00000199240] [ENSMUST00000199420] [ENSMUST00000199571]
Predicted Effect probably benign
Transcript: ENSMUST00000029446
SMART Domains Protein: ENSMUSP00000029446
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196521
Predicted Effect probably benign
Transcript: ENSMUST00000197488
SMART Domains Protein: ENSMUSP00000143524
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 726 757 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197827
SMART Domains Protein: ENSMUSP00000143503
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198180
SMART Domains Protein: ENSMUSP00000142983
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198944
Predicted Effect probably benign
Transcript: ENSMUST00000199240
SMART Domains Protein: ENSMUSP00000143050
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 57 118 9e-22 SMART
CSP 220 283 3.8e-18 SMART
CSP 390 452 1.7e-17 SMART
CSP 545 608 1.4e-18 SMART
Pfam:SUZ-C 626 659 6.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199420
SMART Domains Protein: ENSMUSP00000142703
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199571
SMART Domains Protein: ENSMUSP00000143028
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.7%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,611 Y202C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl3 T G 5: 81,387,979 M155R probably damaging Het
Ak9 A T 10: 41,335,921 Q218L possibly damaging Het
Akap13 G A 7: 75,677,194 G647D probably damaging Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Arhgap19 A G 19: 41,784,381 I291T probably benign Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
BC067074 T G 13: 113,367,500 L179R possibly damaging Het
Bsn T C 9: 108,106,934 D3307G unknown Het
Ces2h T A 8: 105,019,065 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a3 T C 1: 90,816,361 E88G probably damaging Het
Coro6 A G 11: 77,469,425 D407G probably benign Het
Cpe A T 8: 64,611,441 F241L probably damaging Het
Dgki A G 6: 37,057,432 I361T possibly damaging Het
Dnah3 A G 7: 120,035,359 V1298A probably damaging Het
Duox2 T A 2: 122,293,414 I430F probably damaging Het
Gak T C 5: 108,616,976 Y153C probably damaging Het
Gal3st2 T A 1: 93,874,596 probably null Het
Gbp11 T C 5: 105,326,644 N389D probably benign Het
Grm1 A G 10: 10,936,419 V287A probably damaging Het
Hsp90ab1 T C 17: 45,571,806 K36E probably damaging Het
Il24 T A 1: 130,887,362 probably null Het
Ino80d T C 1: 63,093,465 D13G probably damaging Het
Ipp G A 4: 116,530,421 V399I probably benign Het
Kank3 A T 17: 33,817,194 D12V probably damaging Het
Lcn12 A T 2: 25,493,251 S74R probably damaging Het
Mast3 T C 8: 70,784,556 T637A probably benign Het
Nes C A 3: 87,976,421 Y662* probably null Het
Nudt13 A T 14: 20,309,694 H163L probably damaging Het
Olfr1046 A T 2: 86,217,716 probably null Het
Olfr1178 G A 2: 88,391,327 V27I probably benign Het
Olfr1239 T C 2: 89,418,018 T132A probably benign Het
Olfr346 T C 2: 36,688,785 V261A probably benign Het
Pde6b C T 5: 108,430,559 R788* probably null Het
Pex13 A G 11: 23,649,458 L351P probably benign Het
Phc1 A G 6: 122,318,566 M942T probably damaging Het
Plch1 A T 3: 63,719,238 D571E probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhh2 A G 17: 84,566,697 N470S possibly damaging Het
Primpol A G 8: 46,607,838 S82P probably damaging Het
Prkg1 T C 19: 30,786,922 D256G possibly damaging Het
Prune2 A G 19: 17,125,010 E2511G probably benign Het
Rassf8 T C 6: 145,815,308 I120T probably benign Het
Rfx4 G A 10: 84,880,975 probably null Het
Rtp2 A T 16: 23,927,673 N69K probably benign Het
Sh3d19 A T 3: 86,120,606 I597F probably damaging Het
Sorl1 T A 9: 42,089,965 E246D probably benign Het
Spert C T 14: 75,593,057 M1I probably null Het
Tet2 T A 3: 133,481,387 I1094L probably benign Het
Tlr4 A T 4: 66,841,076 H702L probably benign Het
Tnfrsf14 T C 4: 154,925,331 D47G probably damaging Het
Ttn T C 2: 76,946,813 Y1415C probably damaging Het
Vmn2r17 T A 5: 109,428,511 F416Y probably benign Het
Vmn2r54 A G 7: 12,635,888 S83P probably benign Het
Vtn A G 11: 78,499,596 D53G possibly damaging Het
Vwde A T 6: 13,190,724 V456D probably damaging Het
Wdr91 G A 6: 34,884,308 P653L probably damaging Het
Ythdf1 G A 2: 180,911,492 A283V probably benign Het
Zfp975 C A 7: 42,662,949 W80L probably benign Het
Other mutations in Csde1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Csde1 APN 3 103040525 missense possibly damaging 0.80
IGL01419:Csde1 APN 3 103038770 missense probably damaging 1.00
IGL02147:Csde1 APN 3 103039934 missense probably damaging 1.00
IGL02161:Csde1 APN 3 103050338 missense probably damaging 0.99
IGL02442:Csde1 APN 3 103054819 missense probably benign 0.20
IGL03036:Csde1 APN 3 103043839 missense probably damaging 0.99
R0526:Csde1 UTSW 3 103056426 missense possibly damaging 0.76
R0727:Csde1 UTSW 3 103043638 missense probably benign
R1744:Csde1 UTSW 3 103050315 missense probably benign 0.31
R2007:Csde1 UTSW 3 103044791 missense probably damaging 1.00
R4665:Csde1 UTSW 3 103047072 missense probably damaging 1.00
R4806:Csde1 UTSW 3 103056369 unclassified probably benign
R5202:Csde1 UTSW 3 103039934 missense probably damaging 1.00
R5298:Csde1 UTSW 3 103047209 intron probably null
R5429:Csde1 UTSW 3 103052841 missense possibly damaging 0.75
R5896:Csde1 UTSW 3 103040543 intron probably benign
R6076:Csde1 UTSW 3 103041229 missense possibly damaging 0.82
R6093:Csde1 UTSW 3 103052902 missense probably damaging 1.00
R6118:Csde1 UTSW 3 103054754 missense probably benign 0.45
R6213:Csde1 UTSW 3 103040514 missense probably damaging 1.00
R6263:Csde1 UTSW 3 103040017 missense probably benign 0.05
R6653:Csde1 UTSW 3 103052868 missense probably damaging 1.00
R6894:Csde1 UTSW 3 103044656 missense possibly damaging 0.56
R7155:Csde1 UTSW 3 103039953 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTGTACTGTGAGATTGCCCG -3'
(R):5'- AGTATTGCTTTGTCCAGATGCCTCC -3'

Sequencing Primer
(F):5'- GGTGCAGCAGCAGTTGTATTC -3'
(R):5'- AGCACCGAGAACCTTCTCTTTTAG -3'
Posted On2014-05-23