Incidental Mutation 'R1738:Phc1'
ID199863
Institutional Source Beutler Lab
Gene Symbol Phc1
Ensembl Gene ENSMUSG00000040669
Gene Namepolyhomeotic 1
Synonymsrae28, Rae-28, Mph1, Edr1
MMRRC Submission 039770-MU
Accession Numbers

Genbank: NM_007905, NM_001042623; MGI: 103248

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1738 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location122317731-122340561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122318566 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 942 (M942T)
Ref Sequence ENSEMBL: ENSMUSP00000124678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007602] [ENSMUST00000079560] [ENSMUST00000081849] [ENSMUST00000112600] [ENSMUST00000112610] [ENSMUST00000159252] [ENSMUST00000160163] [ENSMUST00000160696] [ENSMUST00000161054] [ENSMUST00000161739]
Predicted Effect probably benign
Transcript: ENSMUST00000007602
SMART Domains Protein: ENSMUSP00000007602
Gene: ENSMUSG00000007458

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 4.5e-184 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000079560
AA Change: M987T
SMART Domains Protein: ENSMUSP00000078514
Gene: ENSMUSG00000040669
AA Change: M987T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000081849
AA Change: M935T
SMART Domains Protein: ENSMUSP00000080532
Gene: ENSMUSG00000040669
AA Change: M935T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000112600
AA Change: M935T
SMART Domains Protein: ENSMUSP00000108219
Gene: ENSMUSG00000040669
AA Change: M935T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112610
SMART Domains Protein: ENSMUSP00000108229
Gene: ENSMUSG00000007458

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 3.9e-200 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123093
Predicted Effect probably damaging
Transcript: ENSMUST00000159252
AA Change: M942T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124678
Gene: ENSMUSG00000040669
AA Change: M942T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 46 65 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 195 258 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 328 371 N/A INTRINSIC
coiled coil region 375 401 N/A INTRINSIC
low complexity region 403 435 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 530 542 N/A INTRINSIC
low complexity region 572 583 N/A INTRINSIC
low complexity region 659 677 N/A INTRINSIC
Pfam:zf-FCS 753 788 2.2e-8 PFAM
low complexity region 810 824 N/A INTRINSIC
SAM 898 965 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160163
SMART Domains Protein: ENSMUSP00000125545
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160696
AA Change: M987T
SMART Domains Protein: ENSMUSP00000125580
Gene: ENSMUSG00000040669
AA Change: M987T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 834 941 3.4e-31 PFAM
SAM 943 1010 9.57e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161054
AA Change: M935T
SMART Domains Protein: ENSMUSP00000123911
Gene: ENSMUSG00000040669
AA Change: M935T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161739
AA Change: M987T
SMART Domains Protein: ENSMUSP00000125568
Gene: ENSMUSG00000040669
AA Change: M987T

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161877
SMART Domains Protein: ENSMUSP00000123854
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.7%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila polyhomeotic gene, which is a member of the Polycomb group of genes. The gene product is a component of a multimeric protein complex that contains EDR2 and the vertebrate Polycomb protein BMH1. The gene product, the EDR2 protein, and the Drosophila polyhomeotic protein share 2 highly conserved domains, named homology domains I and II. These domains are involved in protein-protein interactions and may mediate heterodimerization of the protein encoded by this gene and the EDR2 protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit perinatal lethality, posterior skeletal transformations and defects in neural crest derived tissues, including ocular abnormalities, cleft palate, parathyroid and thymic hypoplasia and cardiac anomalies. Hematopoiesis is impaired in fetal livers. [provided by MGI curators]
Allele List at MGI

All alleles(147) : Targeted, knock-out(1) Gene trapped(146)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,611 Y202C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl3 T G 5: 81,387,979 M155R probably damaging Het
Ak9 A T 10: 41,335,921 Q218L possibly damaging Het
Akap13 G A 7: 75,677,194 G647D probably damaging Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Arhgap19 A G 19: 41,784,381 I291T probably benign Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
BC067074 T G 13: 113,367,500 L179R possibly damaging Het
Bsn T C 9: 108,106,934 D3307G unknown Het
Ces2h T A 8: 105,019,065 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a3 T C 1: 90,816,361 E88G probably damaging Het
Coro6 A G 11: 77,469,425 D407G probably benign Het
Cpe A T 8: 64,611,441 F241L probably damaging Het
Csde1 A G 3: 103,029,177 probably benign Het
Dgki A G 6: 37,057,432 I361T possibly damaging Het
Dnah3 A G 7: 120,035,359 V1298A probably damaging Het
Duox2 T A 2: 122,293,414 I430F probably damaging Het
Gak T C 5: 108,616,976 Y153C probably damaging Het
Gal3st2 T A 1: 93,874,596 probably null Het
Gbp11 T C 5: 105,326,644 N389D probably benign Het
Grm1 A G 10: 10,936,419 V287A probably damaging Het
Hsp90ab1 T C 17: 45,571,806 K36E probably damaging Het
Il24 T A 1: 130,887,362 probably null Het
Ino80d T C 1: 63,093,465 D13G probably damaging Het
Ipp G A 4: 116,530,421 V399I probably benign Het
Kank3 A T 17: 33,817,194 D12V probably damaging Het
Lcn12 A T 2: 25,493,251 S74R probably damaging Het
Mast3 T C 8: 70,784,556 T637A probably benign Het
Nes C A 3: 87,976,421 Y662* probably null Het
Nudt13 A T 14: 20,309,694 H163L probably damaging Het
Olfr1046 A T 2: 86,217,716 probably null Het
Olfr1178 G A 2: 88,391,327 V27I probably benign Het
Olfr1239 T C 2: 89,418,018 T132A probably benign Het
Olfr346 T C 2: 36,688,785 V261A probably benign Het
Pde6b C T 5: 108,430,559 R788* probably null Het
Pex13 A G 11: 23,649,458 L351P probably benign Het
Plch1 A T 3: 63,719,238 D571E probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhh2 A G 17: 84,566,697 N470S possibly damaging Het
Primpol A G 8: 46,607,838 S82P probably damaging Het
Prkg1 T C 19: 30,786,922 D256G possibly damaging Het
Prune2 A G 19: 17,125,010 E2511G probably benign Het
Rassf8 T C 6: 145,815,308 I120T probably benign Het
Rfx4 G A 10: 84,880,975 probably null Het
Rtp2 A T 16: 23,927,673 N69K probably benign Het
Sh3d19 A T 3: 86,120,606 I597F probably damaging Het
Sorl1 T A 9: 42,089,965 E246D probably benign Het
Spert C T 14: 75,593,057 M1I probably null Het
Tet2 T A 3: 133,481,387 I1094L probably benign Het
Tlr4 A T 4: 66,841,076 H702L probably benign Het
Tnfrsf14 T C 4: 154,925,331 D47G probably damaging Het
Ttn T C 2: 76,946,813 Y1415C probably damaging Het
Vmn2r17 T A 5: 109,428,511 F416Y probably benign Het
Vmn2r54 A G 7: 12,635,888 S83P probably benign Het
Vtn A G 11: 78,499,596 D53G possibly damaging Het
Vwde A T 6: 13,190,724 V456D probably damaging Het
Wdr91 G A 6: 34,884,308 P653L probably damaging Het
Ythdf1 G A 2: 180,911,492 A283V probably benign Het
Zfp975 C A 7: 42,662,949 W80L probably benign Het
Other mutations in Phc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Phc1 APN 6 122322999 splice site probably benign
IGL01354:Phc1 APN 6 122334083 missense probably damaging 1.00
IGL01786:Phc1 APN 6 122319520 missense possibly damaging 0.82
IGL02110:Phc1 APN 6 122322035 missense possibly damaging 0.91
IGL02479:Phc1 APN 6 122323717 unclassified probably benign
IGL02861:Phc1 APN 6 122323789 unclassified probably benign
IGL03106:Phc1 APN 6 122323469 unclassified probably benign
3-1:Phc1 UTSW 6 122338464 intron probably benign
FR4737:Phc1 UTSW 6 122323598 small insertion probably benign
FR4976:Phc1 UTSW 6 122323600 small insertion probably benign
R0452:Phc1 UTSW 6 122323036 missense probably damaging 1.00
R1146:Phc1 UTSW 6 122323457 unclassified probably benign
R1146:Phc1 UTSW 6 122323457 unclassified probably benign
R1301:Phc1 UTSW 6 122325874 missense probably benign 0.03
R2056:Phc1 UTSW 6 122333340 missense probably damaging 0.99
R2164:Phc1 UTSW 6 122322337 missense possibly damaging 0.82
R2183:Phc1 UTSW 6 122323325 missense probably damaging 1.00
R2424:Phc1 UTSW 6 122320043 missense probably damaging 0.98
R4378:Phc1 UTSW 6 122335007 missense possibly damaging 0.66
R4648:Phc1 UTSW 6 122321913 missense possibly damaging 0.95
R4831:Phc1 UTSW 6 122337005 start gained probably benign
R5244:Phc1 UTSW 6 122321979 missense probably damaging 1.00
R5475:Phc1 UTSW 6 122334092 missense possibly damaging 0.95
R6491:Phc1 UTSW 6 122334964
R6701:Phc1 UTSW 6 122325774 missense probably damaging 0.96
R6733:Phc1 UTSW 6 122336886 missense possibly damaging 0.77
R7022:Phc1 UTSW 6 122335031 missense probably damaging 0.98
R7383:Phc1 UTSW 6 122323358 missense unknown
R7707:Phc1 UTSW 6 122323780 missense unknown
X0024:Phc1 UTSW 6 122323629 small deletion probably benign
X0026:Phc1 UTSW 6 122319538 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGTAGCACCAGCAACCAATCCTTAG -3'
(R):5'- TGCTTTCAGAGCTTGCCTCAGAC -3'

Sequencing Primer
(F):5'- GAGTTCTGCCTCCAAACCC -3'
(R):5'- GAGTTTCGTTCCCAGGAGAT -3'
Posted On2014-05-23