Incidental Mutation 'R1791:Clip4'
ID201784
Institutional Source Beutler Lab
Gene Symbol Clip4
Ensembl Gene ENSMUSG00000024059
Gene NameCAP-GLY domain containing linker protein family, member 4
Synonyms1700024K14Rik, Rsnl2, 1700074B05Rik, 4833417L20Rik, 5830409B12Rik
MMRRC Submission 039821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R1791 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71768473-71864273 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 71801942 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024854] [ENSMUST00000229288] [ENSMUST00000229304] [ENSMUST00000229874] [ENSMUST00000229952] [ENSMUST00000230305] [ENSMUST00000230333] [ENSMUST00000230427] [ENSMUST00000230747] [ENSMUST00000230749] [ENSMUST00000231105]
Predicted Effect probably benign
Transcript: ENSMUST00000024854
SMART Domains Protein: ENSMUSP00000024854
Gene: ENSMUSG00000024059

DomainStartEndE-ValueType
ANK 106 144 4.58e2 SMART
ANK 149 180 3.26e0 SMART
ANK 186 215 3.26e0 SMART
CAP_GLY 285 350 6.63e-34 SMART
low complexity region 358 371 N/A INTRINSIC
low complexity region 389 403 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 469 478 N/A INTRINSIC
CAP_GLY 486 551 5.52e-31 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
CAP_GLY 624 690 5.65e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229288
Predicted Effect probably benign
Transcript: ENSMUST00000229304
Predicted Effect probably benign
Transcript: ENSMUST00000229874
Predicted Effect probably benign
Transcript: ENSMUST00000229952
Predicted Effect probably benign
Transcript: ENSMUST00000230305
Predicted Effect probably benign
Transcript: ENSMUST00000230333
Predicted Effect probably benign
Transcript: ENSMUST00000230427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230700
Predicted Effect probably benign
Transcript: ENSMUST00000230747
Predicted Effect probably benign
Transcript: ENSMUST00000230749
Predicted Effect probably benign
Transcript: ENSMUST00000231105
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency 95% (104/110)
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Akap13 T G 7: 75,611,035 C333G probably benign Het
Akap6 T C 12: 53,069,125 S1004P probably damaging Het
Akap7 T C 10: 25,239,685 T181A probably benign Het
Ap3b1 A G 13: 94,408,797 E186G possibly damaging Het
Arhgap17 T C 7: 123,286,702 T736A probably benign Het
Bmp8a G T 4: 123,324,585 R214S possibly damaging Het
Cacna1f T C X: 7,620,439 S890P probably damaging Het
Cd96 A T 16: 46,117,999 Y34* probably null Het
Cdc42ep4 A G 11: 113,729,337 L76P probably damaging Het
Cdh23 A G 10: 60,391,726 V1195A possibly damaging Het
Cfap57 G A 4: 118,571,724 T1015M possibly damaging Het
Chrm3 C A 13: 9,877,416 G528V probably damaging Het
Col9a1 A T 1: 24,185,305 R189S unknown Het
Cul4b A T X: 38,547,851 I481N probably damaging Het
Cyp26b1 A G 6: 84,584,459 S74P probably benign Het
Cyp3a57 A G 5: 145,371,010 N192S probably benign Het
Dcbld1 A G 10: 52,319,476 D260G probably damaging Het
Dhrs7 T C 12: 72,653,165 N231S probably benign Het
Disp3 G A 4: 148,241,518 P1261L probably damaging Het
Dyx1c1 T C 9: 72,960,684 Y76H possibly damaging Het
Eml5 C A 12: 98,887,056 V95F probably benign Het
Emsy A G 7: 98,647,880 I32T probably damaging Het
Esr1 A G 10: 4,783,913 R238G probably damaging Het
Exosc1 T C 19: 41,928,085 K84R probably benign Het
F830016B08Rik T A 18: 60,300,517 V224E probably benign Het
Fam228a T A 12: 4,732,748 N115I probably damaging Het
Farp1 T C 14: 121,256,745 I546T probably damaging Het
Fbxo30 T A 10: 11,289,787 C84* probably null Het
Fbxw17 A G 13: 50,425,774 probably benign Het
Foxo4 G C X: 101,258,463 R192P probably benign Het
Galnt7 G T 8: 57,542,530 T377K probably benign Het
Garnl3 T C 2: 33,034,127 I248V probably benign Het
Glod4 A G 11: 76,237,708 Y104H probably damaging Het
Glrb T C 3: 80,860,175 Y246C probably damaging Het
Gm5292 A G 5: 43,944,410 noncoding transcript Het
Gm5424 C A 10: 62,072,307 noncoding transcript Het
Gm7276 C T 18: 77,185,735 probably benign Het
Gm9774 T A 3: 92,428,231 D388V probably damaging Het
Golga5 A G 12: 102,492,131 N611S possibly damaging Het
Gucy2c A C 6: 136,744,027 Y391D probably damaging Het
H6pd A G 4: 149,981,673 I760T probably damaging Het
Hapln2 T A 3: 88,024,405 I5F possibly damaging Het
Hdac11 G T 6: 91,168,824 V169L probably benign Het
Hectd2 T C 19: 36,609,416 V557A possibly damaging Het
Huwe1 T A X: 151,864,753 N747K probably benign Het
Ints1 A G 5: 139,774,522 S66P probably benign Het
Ipo7 A G 7: 110,027,132 D49G probably damaging Het
Itgb4 G A 11: 115,988,520 C575Y probably damaging Het
Klhl3 A G 13: 58,033,230 V250A possibly damaging Het
Klk1b24 A G 7: 44,190,428 probably null Het
Map3k11 T A 19: 5,695,572 Y333* probably null Het
Mbp A G 18: 82,554,349 T57A probably benign Het
Myh9 A G 15: 77,773,264 probably benign Het
Mypn C T 10: 63,125,693 R1040Q probably damaging Het
Ncdn A G 4: 126,751,939 probably null Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Odf3l1 A T 9: 56,851,743 F43I possibly damaging Het
Olfr509 T A 7: 108,646,364 T71S probably benign Het
Olfr566 G A 7: 102,856,362 Q307* probably null Het
Olfr623 T C 7: 103,660,798 probably null Het
Olfr726 A G 14: 50,084,042 F213S probably benign Het
Olfr749 AGGGATTGGG AGGGATTGGGATTGGG 14: 50,736,687 probably benign Het
Olfr924 T A 9: 38,848,605 S164T possibly damaging Het
Pbx3 T C 2: 34,224,452 T82A possibly damaging Het
Pi15 T C 1: 17,602,721 F48S probably benign Het
Pkhd1 A G 1: 20,585,152 probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Prrc2c G T 1: 162,704,982 probably benign Het
Prune1 A G 3: 95,268,242 Y41H possibly damaging Het
Rcsd1 T C 1: 165,655,972 D150G probably damaging Het
Rgs12 A T 5: 34,966,112 Q413L possibly damaging Het
Rhox2h A G X: 37,669,195 Y185H probably damaging Het
Rnf17 T A 14: 56,504,007 C1306* probably null Het
Ros1 T A 10: 52,100,087 M1499L probably benign Het
Rubcnl T C 14: 75,047,549 S503P probably damaging Het
Sap18b A T 8: 95,825,714 R117S probably benign Het
Shank2 A G 7: 144,410,599 E858G probably damaging Het
Shtn1 T C 19: 59,032,200 R197G probably damaging Het
Slamf8 G A 1: 172,584,520 R163* probably null Het
Slc6a3 T C 13: 73,566,292 I392T possibly damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Sp8 T C 12: 118,849,016 V202A possibly damaging Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Stpg2 A T 3: 139,317,401 T393S probably benign Het
Tagap T C 17: 7,931,467 M228T probably damaging Het
Tagap A G 17: 7,933,545 T521A probably benign Het
Tas2r123 T G 6: 132,847,565 S142A probably damaging Het
Tat T A 8: 109,991,629 S49T probably benign Het
Tfap4 G T 16: 4,552,069 Q41K possibly damaging Het
Thbs2 T C 17: 14,685,813 N275S probably benign Het
Tnfsf14 T A 17: 57,190,867 R122W probably damaging Het
Tnrc6a T C 7: 123,192,917 V1886A possibly damaging Het
Trim56 G A 5: 137,114,398 A88V probably damaging Het
Trio A G 15: 27,841,756 Y1081H probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ube2o G A 11: 116,541,494 T882I probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Upk3a A G 15: 85,020,614 T188A possibly damaging Het
Vmn1r79 A C 7: 12,176,431 D80A probably damaging Het
Wls C A 3: 159,911,813 T375K probably benign Het
Wnt5a T C 14: 28,511,878 M1T probably null Het
Zcchc4 A G 5: 52,796,590 E204G probably damaging Het
Zfp513 G A 5: 31,200,334 P232S possibly damaging Het
Other mutations in Clip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Clip4 APN 17 71849942 missense probably damaging 1.00
IGL01011:Clip4 APN 17 71849939 missense probably benign 0.02
IGL01086:Clip4 APN 17 71824794 missense probably benign 0.00
IGL01712:Clip4 APN 17 71799041 missense probably damaging 1.00
IGL01833:Clip4 APN 17 71827790 unclassified probably benign
IGL02150:Clip4 APN 17 71799076 missense probably damaging 1.00
IGL02378:Clip4 APN 17 71837726 missense possibly damaging 0.94
IGL02597:Clip4 APN 17 71849970 splice site probably benign
IGL02676:Clip4 APN 17 71828621 missense probably damaging 1.00
PIT4243001:Clip4 UTSW 17 71806728 missense probably damaging 0.98
R0525:Clip4 UTSW 17 71799098 critical splice donor site probably null
R0737:Clip4 UTSW 17 71837699 nonsense probably null
R1908:Clip4 UTSW 17 71837749 missense probably damaging 1.00
R2290:Clip4 UTSW 17 71810953 missense possibly damaging 0.96
R3701:Clip4 UTSW 17 71799008 missense probably damaging 0.96
R4001:Clip4 UTSW 17 71799076 missense probably damaging 1.00
R4013:Clip4 UTSW 17 71856546 nonsense probably null
R4589:Clip4 UTSW 17 71810867 nonsense probably null
R4837:Clip4 UTSW 17 71834222 missense probably damaging 1.00
R5174:Clip4 UTSW 17 71810962 missense probably damaging 1.00
R5239:Clip4 UTSW 17 71799077 missense probably damaging 1.00
R5298:Clip4 UTSW 17 71834225 missense probably damaging 1.00
R5535:Clip4 UTSW 17 71831262 missense probably benign
R5667:Clip4 UTSW 17 71789883 start codon destroyed probably damaging 1.00
R5671:Clip4 UTSW 17 71789883 start codon destroyed probably damaging 1.00
R5730:Clip4 UTSW 17 71810959 missense probably damaging 1.00
R5768:Clip4 UTSW 17 71806499 splice site probably null
R5913:Clip4 UTSW 17 71824765 missense probably benign 0.00
R5974:Clip4 UTSW 17 71831247 missense probably damaging 1.00
R5996:Clip4 UTSW 17 71856310 missense probably damaging 0.99
R6176:Clip4 UTSW 17 71806633 nonsense probably null
R6371:Clip4 UTSW 17 71856464 missense probably damaging 1.00
R6386:Clip4 UTSW 17 71834194 nonsense probably null
R7296:Clip4 UTSW 17 71790001 missense probably damaging 0.99
R7546:Clip4 UTSW 17 71828702 missense possibly damaging 0.85
R7548:Clip4 UTSW 17 71789968 missense probably benign
R7616:Clip4 UTSW 17 71834273 missense probably benign 0.00
R8054:Clip4 UTSW 17 71834273 missense possibly damaging 0.68
R8056:Clip4 UTSW 17 71803592 missense probably damaging 1.00
Z1177:Clip4 UTSW 17 71799097 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCAGGTGATATTGAGACAGCTG -3'
(R):5'- ACTATACTAGAGAAGCTGCAGAGAC -3'

Sequencing Primer
(F):5'- GAGACAGCTGTAAAATTTGCTGCTC -3'
(R):5'- AACTTGTAGCTCTTTGTACTAAGCC -3'
Posted On2014-06-23