Incidental Mutation 'R1791:Trio'
ID201773
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Nametriple functional domain (PTPRF interacting)
SynonymsSolo, 6720464I07Rik
MMRRC Submission 039821-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1791 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location27730651-28025848 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27841756 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1081 (Y1081H)
Ref Sequence ENSEMBL: ENSMUSP00000154653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644] [ENSMUST00000227337]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090247
AA Change: Y1140H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: Y1140H

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226117
Predicted Effect probably benign
Transcript: ENSMUST00000226644
Predicted Effect probably damaging
Transcript: ENSMUST00000227337
AA Change: Y1081H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6860 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Akap13 T G 7: 75,611,035 C333G probably benign Het
Akap6 T C 12: 53,069,125 S1004P probably damaging Het
Akap7 T C 10: 25,239,685 T181A probably benign Het
Ap3b1 A G 13: 94,408,797 E186G possibly damaging Het
Arhgap17 T C 7: 123,286,702 T736A probably benign Het
Bmp8a G T 4: 123,324,585 R214S possibly damaging Het
Cacna1f T C X: 7,620,439 S890P probably damaging Het
Cd96 A T 16: 46,117,999 Y34* probably null Het
Cdc42ep4 A G 11: 113,729,337 L76P probably damaging Het
Cdh23 A G 10: 60,391,726 V1195A possibly damaging Het
Cfap57 G A 4: 118,571,724 T1015M possibly damaging Het
Chrm3 C A 13: 9,877,416 G528V probably damaging Het
Clip4 T C 17: 71,801,942 probably benign Het
Col9a1 A T 1: 24,185,305 R189S unknown Het
Cul4b A T X: 38,547,851 I481N probably damaging Het
Cyp26b1 A G 6: 84,584,459 S74P probably benign Het
Cyp3a57 A G 5: 145,371,010 N192S probably benign Het
Dcbld1 A G 10: 52,319,476 D260G probably damaging Het
Dhrs7 T C 12: 72,653,165 N231S probably benign Het
Disp3 G A 4: 148,241,518 P1261L probably damaging Het
Dyx1c1 T C 9: 72,960,684 Y76H possibly damaging Het
Eml5 C A 12: 98,887,056 V95F probably benign Het
Emsy A G 7: 98,647,880 I32T probably damaging Het
Esr1 A G 10: 4,783,913 R238G probably damaging Het
Exosc1 T C 19: 41,928,085 K84R probably benign Het
F830016B08Rik T A 18: 60,300,517 V224E probably benign Het
Fam228a T A 12: 4,732,748 N115I probably damaging Het
Farp1 T C 14: 121,256,745 I546T probably damaging Het
Fbxo30 T A 10: 11,289,787 C84* probably null Het
Fbxw17 A G 13: 50,425,774 probably benign Het
Foxo4 G C X: 101,258,463 R192P probably benign Het
Galnt7 G T 8: 57,542,530 T377K probably benign Het
Garnl3 T C 2: 33,034,127 I248V probably benign Het
Glod4 A G 11: 76,237,708 Y104H probably damaging Het
Glrb T C 3: 80,860,175 Y246C probably damaging Het
Gm5292 A G 5: 43,944,410 noncoding transcript Het
Gm5424 C A 10: 62,072,307 noncoding transcript Het
Gm7276 C T 18: 77,185,735 probably benign Het
Gm9774 T A 3: 92,428,231 D388V probably damaging Het
Golga5 A G 12: 102,492,131 N611S possibly damaging Het
Gucy2c A C 6: 136,744,027 Y391D probably damaging Het
H6pd A G 4: 149,981,673 I760T probably damaging Het
Hapln2 T A 3: 88,024,405 I5F possibly damaging Het
Hdac11 G T 6: 91,168,824 V169L probably benign Het
Hectd2 T C 19: 36,609,416 V557A possibly damaging Het
Huwe1 T A X: 151,864,753 N747K probably benign Het
Ints1 A G 5: 139,774,522 S66P probably benign Het
Ipo7 A G 7: 110,027,132 D49G probably damaging Het
Itgb4 G A 11: 115,988,520 C575Y probably damaging Het
Klhl3 A G 13: 58,033,230 V250A possibly damaging Het
Klk1b24 A G 7: 44,190,428 probably null Het
Map3k11 T A 19: 5,695,572 Y333* probably null Het
Mbp A G 18: 82,554,349 T57A probably benign Het
Myh9 A G 15: 77,773,264 probably benign Het
Mypn C T 10: 63,125,693 R1040Q probably damaging Het
Ncdn A G 4: 126,751,939 probably null Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Odf3l1 A T 9: 56,851,743 F43I possibly damaging Het
Olfr509 T A 7: 108,646,364 T71S probably benign Het
Olfr566 G A 7: 102,856,362 Q307* probably null Het
Olfr623 T C 7: 103,660,798 probably null Het
Olfr726 A G 14: 50,084,042 F213S probably benign Het
Olfr749 AGGGATTGGG AGGGATTGGGATTGGG 14: 50,736,687 probably benign Het
Olfr924 T A 9: 38,848,605 S164T possibly damaging Het
Pbx3 T C 2: 34,224,452 T82A possibly damaging Het
Pi15 T C 1: 17,602,721 F48S probably benign Het
Pkhd1 A G 1: 20,585,152 probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Prrc2c G T 1: 162,704,982 probably benign Het
Prune1 A G 3: 95,268,242 Y41H possibly damaging Het
Rcsd1 T C 1: 165,655,972 D150G probably damaging Het
Rgs12 A T 5: 34,966,112 Q413L possibly damaging Het
Rhox2h A G X: 37,669,195 Y185H probably damaging Het
Rnf17 T A 14: 56,504,007 C1306* probably null Het
Ros1 T A 10: 52,100,087 M1499L probably benign Het
Rubcnl T C 14: 75,047,549 S503P probably damaging Het
Sap18b A T 8: 95,825,714 R117S probably benign Het
Shank2 A G 7: 144,410,599 E858G probably damaging Het
Shtn1 T C 19: 59,032,200 R197G probably damaging Het
Slamf8 G A 1: 172,584,520 R163* probably null Het
Slc6a3 T C 13: 73,566,292 I392T possibly damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Sp8 T C 12: 118,849,016 V202A possibly damaging Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Stpg2 A T 3: 139,317,401 T393S probably benign Het
Tagap T C 17: 7,931,467 M228T probably damaging Het
Tagap A G 17: 7,933,545 T521A probably benign Het
Tas2r123 T G 6: 132,847,565 S142A probably damaging Het
Tat T A 8: 109,991,629 S49T probably benign Het
Tfap4 G T 16: 4,552,069 Q41K possibly damaging Het
Thbs2 T C 17: 14,685,813 N275S probably benign Het
Tnfsf14 T A 17: 57,190,867 R122W probably damaging Het
Tnrc6a T C 7: 123,192,917 V1886A possibly damaging Het
Trim56 G A 5: 137,114,398 A88V probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ube2o G A 11: 116,541,494 T882I probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Upk3a A G 15: 85,020,614 T188A possibly damaging Het
Vmn1r79 A C 7: 12,176,431 D80A probably damaging Het
Wls C A 3: 159,911,813 T375K probably benign Het
Wnt5a T C 14: 28,511,878 M1T probably null Het
Zcchc4 A G 5: 52,796,590 E204G probably damaging Het
Zfp513 G A 5: 31,200,334 P232S possibly damaging Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27912743 splice site probably benign
IGL01011:Trio APN 15 27736489 missense probably damaging 0.96
IGL01090:Trio APN 15 27773007 missense probably damaging 1.00
IGL01145:Trio APN 15 27818167 splice site probably benign
IGL01147:Trio APN 15 27881320 missense probably damaging 1.00
IGL01161:Trio APN 15 27749781 missense probably damaging 1.00
IGL01324:Trio APN 15 27905323 missense probably benign 0.42
IGL01352:Trio APN 15 27901229 missense probably benign 0.01
IGL01366:Trio APN 15 27732868 missense possibly damaging 0.76
IGL01443:Trio APN 15 27838775 splice site probably benign
IGL01454:Trio APN 15 27832985 missense probably benign 0.32
IGL01695:Trio APN 15 27773001 missense probably damaging 1.00
IGL01765:Trio APN 15 27764026 missense possibly damaging 0.85
IGL01860:Trio APN 15 27846810 missense probably damaging 1.00
IGL01879:Trio APN 15 27741033 missense probably benign 0.12
IGL01991:Trio APN 15 27871274 missense possibly damaging 0.95
IGL02106:Trio APN 15 27744158 missense possibly damaging 0.85
IGL02209:Trio APN 15 27744053 missense probably damaging 1.00
IGL02232:Trio APN 15 27902561 missense probably benign 0.24
IGL02304:Trio APN 15 27735436 missense probably damaging 0.96
IGL02504:Trio APN 15 27847390 nonsense probably null
IGL02508:Trio APN 15 27818104 missense possibly damaging 0.65
IGL02541:Trio APN 15 27844930 splice site probably benign
IGL02617:Trio APN 15 27841849 splice site probably benign
IGL02675:Trio APN 15 27768039 unclassified probably benign
IGL02817:Trio APN 15 27902881 missense probably benign 0.01
IGL02993:Trio APN 15 27830239 splice site probably benign
IGL03007:Trio APN 15 27902742 missense probably damaging 0.99
IGL03135:Trio APN 15 27832011 splice site probably benign
IGL03225:Trio APN 15 27902695 missense probably benign 0.30
R0063:Trio UTSW 15 27881437 splice site probably benign
R0063:Trio UTSW 15 27881437 splice site probably benign
R0302:Trio UTSW 15 27902517 missense probably damaging 1.00
R0505:Trio UTSW 15 27767907 missense probably benign 0.00
R0506:Trio UTSW 15 27854963 missense probably benign 0.12
R0564:Trio UTSW 15 27805822 missense probably damaging 1.00
R0659:Trio UTSW 15 27831399 missense probably damaging 0.97
R0882:Trio UTSW 15 27732894 missense probably damaging 1.00
R0939:Trio UTSW 15 27741250 critical splice donor site probably null
R1018:Trio UTSW 15 27871171 missense probably damaging 1.00
R1439:Trio UTSW 15 27897914 missense probably damaging 1.00
R1456:Trio UTSW 15 27753804 splice site probably benign
R1488:Trio UTSW 15 27740967 missense probably damaging 1.00
R1522:Trio UTSW 15 27732640 missense probably benign 0.28
R1531:Trio UTSW 15 27832985 missense probably benign 0.32
R1640:Trio UTSW 15 27833044 missense probably damaging 1.00
R1646:Trio UTSW 15 27758347 missense possibly damaging 0.91
R1682:Trio UTSW 15 27744146 splice site probably null
R1780:Trio UTSW 15 27744038 missense possibly damaging 0.93
R1803:Trio UTSW 15 27748340 missense probably benign
R1817:Trio UTSW 15 27742495 nonsense probably null
R1853:Trio UTSW 15 27756536 missense probably damaging 1.00
R1898:Trio UTSW 15 27742380 missense possibly damaging 0.52
R1937:Trio UTSW 15 27833056 missense probably damaging 1.00
R1938:Trio UTSW 15 27732891 missense probably damaging 0.98
R2025:Trio UTSW 15 27744137 missense probably damaging 0.99
R2025:Trio UTSW 15 27773927 missense probably damaging 1.00
R2050:Trio UTSW 15 27851945 missense possibly damaging 0.85
R2186:Trio UTSW 15 27823975 splice site probably null
R2913:Trio UTSW 15 27854912 missense probably damaging 1.00
R3151:Trio UTSW 15 27805776 missense probably damaging 1.00
R3771:Trio UTSW 15 27748091 missense probably damaging 0.98
R3773:Trio UTSW 15 27748091 missense probably damaging 0.98
R3826:Trio UTSW 15 27833070 missense probably damaging 1.00
R4015:Trio UTSW 15 27744101 missense possibly damaging 0.71
R4359:Trio UTSW 15 27749797 nonsense probably null
R4370:Trio UTSW 15 27748337 nonsense probably null
R4547:Trio UTSW 15 27818982 missense possibly damaging 0.89
R4573:Trio UTSW 15 27772998 small deletion probably benign
R4620:Trio UTSW 15 27871171 missense probably damaging 1.00
R4735:Trio UTSW 15 27752789 splice site probably null
R4764:Trio UTSW 15 27732538 nonsense probably null
R4775:Trio UTSW 15 27881342 nonsense probably null
R4942:Trio UTSW 15 27752725 missense probably benign 0.21
R5004:Trio UTSW 15 27755178 missense probably damaging 1.00
R5149:Trio UTSW 15 27754029 missense possibly damaging 0.74
R5183:Trio UTSW 15 27902600 missense probably benign 0.00
R5186:Trio UTSW 15 27897991 missense probably damaging 0.97
R5268:Trio UTSW 15 27748286 missense probably benign 0.02
R5344:Trio UTSW 15 27735532 missense probably benign 0.12
R5407:Trio UTSW 15 27844806 splice site probably null
R5442:Trio UTSW 15 27856194 missense probably benign 0.04
R5617:Trio UTSW 15 27902748 missense probably benign
R5778:Trio UTSW 15 27856164 missense probably benign 0.33
R5986:Trio UTSW 15 27851933 missense possibly damaging 0.88
R5990:Trio UTSW 15 27891459 missense probably benign 0.10
R6011:Trio UTSW 15 27735545 missense probably damaging 0.98
R6063:Trio UTSW 15 27891379 missense possibly damaging 0.94
R6166:Trio UTSW 15 27818071 missense probably damaging 0.96
R6187:Trio UTSW 15 27743952 critical splice donor site probably null
R6387:Trio UTSW 15 27752739 missense probably damaging 1.00
R6402:Trio UTSW 15 27902911 missense probably benign 0.02
R6478:Trio UTSW 15 27856107 missense probably benign 0.01
R6528:Trio UTSW 15 27805870 missense probably damaging 1.00
R6662:Trio UTSW 15 27854996 missense probably benign 0.00
R6825:Trio UTSW 15 27889308 missense probably damaging 0.98
R6890:Trio UTSW 15 27919288 unclassified probably benign
R6945:Trio UTSW 15 27824090 missense probably damaging 1.00
R7027:Trio UTSW 15 27805654 missense possibly damaging 0.86
R7046:Trio UTSW 15 27832051 missense probably damaging 1.00
R7049:Trio UTSW 15 27749799 missense possibly damaging 0.66
R7075:Trio UTSW 15 27898000 missense unknown
R7094:Trio UTSW 15 27891448 missense unknown
R7123:Trio UTSW 15 27742313 critical splice donor site probably benign
R7130:Trio UTSW 15 27742313 critical splice donor site probably benign
R7214:Trio UTSW 15 27871187 missense probably damaging 0.97
R7292:Trio UTSW 15 27828351 missense possibly damaging 0.63
R7293:Trio UTSW 15 27871289 missense possibly damaging 0.66
R7352:Trio UTSW 15 27732876 missense probably damaging 0.96
R7426:Trio UTSW 15 27856107 missense probably benign 0.01
R7451:Trio UTSW 15 27747913 missense probably benign 0.07
R7558:Trio UTSW 15 27831394 missense possibly damaging 0.90
R7578:Trio UTSW 15 27854939 missense possibly damaging 0.94
R7596:Trio UTSW 15 27749826 missense probably damaging 0.99
R7604:Trio UTSW 15 27736445 critical splice donor site probably null
R7609:Trio UTSW 15 27912642 missense unknown
R7767:Trio UTSW 15 27889418 missense unknown
R7784:Trio UTSW 15 27763994 missense probably damaging 1.00
R7817:Trio UTSW 15 27749866 missense probably benign 0.35
R7833:Trio UTSW 15 27774086 missense probably damaging 0.99
R7873:Trio UTSW 15 27805684 missense possibly damaging 0.83
R7879:Trio UTSW 15 27851924 missense possibly damaging 0.94
R7989:Trio UTSW 15 27772935 missense probably damaging 0.97
R8022:Trio UTSW 15 27749866 missense probably benign 0.35
R8050:Trio UTSW 15 27891454 missense unknown
R8217:Trio UTSW 15 27818969 missense probably damaging 0.97
R8280:Trio UTSW 15 27902910 missense unknown
R8283:Trio UTSW 15 27756542 missense possibly damaging 0.79
R8300:Trio UTSW 15 27855022 missense possibly damaging 0.66
R8321:Trio UTSW 15 27881326 missense possibly damaging 0.90
R8477:Trio UTSW 15 27773952 missense possibly damaging 0.83
R8479:Trio UTSW 15 27901200 missense probably benign 0.25
X0024:Trio UTSW 15 27765726 missense possibly damaging 0.91
Z1176:Trio UTSW 15 27771387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGCTCAGGAAACCAAATGG -3'
(R):5'- TCATTTCTTGGCGCAGTCTG -3'

Sequencing Primer
(F):5'- AACCATACGGGCTTAGGGGTTATTG -3'
(R):5'- GGCGCAGTCTGCTTTGC -3'
Posted On2014-06-23