Incidental Mutation 'R1802:Pifo'
ID203197
Institutional Source Beutler Lab
Gene Symbol Pifo
Ensembl Gene ENSMUSG00000010136
Gene Nameprimary cilia formation
Synonymspitchfork, 1700027A23Rik
MMRRC Submission 039832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1802 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location105996957-106014646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106014550 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 19 (Q19L)
Ref Sequence ENSEMBL: ENSMUSP00000010280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010280] [ENSMUST00000066537] [ENSMUST00000200146]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010280
AA Change: Q19L

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000010280
Gene: ENSMUSG00000010136
AA Change: Q19L

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 183 209 5.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054973
SMART Domains Protein: ENSMUSP00000052345
Gene: ENSMUSG00000043873

DomainStartEndE-ValueType
Pfam:Glyco_hydro_18 1 156 5.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066537
SMART Domains Protein: ENSMUSP00000065043
Gene: ENSMUSG00000043873

DomainStartEndE-ValueType
Glyco_18 1 174 2.61e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198855
Predicted Effect probably benign
Transcript: ENSMUST00000200146
SMART Domains Protein: ENSMUSP00000142477
Gene: ENSMUSG00000043873

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 2.1e-133 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Heterozygous null embryos generated by tetraploid complementation display embryonic lethality with double outlet heart right ventricle, duplicated cilia and defects in cilia disassembly. A conditional allele activated in limb bub cultures doesn't interfere with cilia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik T A 11: 101,988,476 Y25N possibly damaging Het
Abcd2 G T 15: 91,163,102 R583S probably benign Het
Ago2 A T 15: 73,121,180 F492Y probably damaging Het
Ano4 T A 10: 88,981,016 D610V probably damaging Het
Atp6v0d2 A G 4: 19,922,366 probably null Het
Atxn7 T G 14: 14,089,419 S312A probably benign Het
Azgp1 A G 5: 137,985,231 Y56C probably damaging Het
Bcan A G 3: 87,993,108 V606A possibly damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
Ccdc63 T C 5: 122,129,877 R9G probably damaging Het
Cdyl T A 13: 35,872,636 L534* probably null Het
Celf2 T C 2: 6,549,933 E445G probably damaging Het
Cnot8 T C 11: 58,117,535 C276R probably benign Het
Dock4 A G 12: 40,794,598 I1135V possibly damaging Het
Edc3 A G 9: 57,727,315 D205G probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Fancl T G 11: 26,459,709 S188R probably benign Het
Fbn2 T A 18: 58,052,976 K1767* probably null Het
Glrb A T 3: 80,861,957 H154Q probably damaging Het
Gm19965 C T 1: 116,820,903 R105* probably null Het
Grhpr C A 4: 44,988,950 Y202* probably null Het
Herc2 A G 7: 56,184,332 E3095G probably damaging Het
Il22ra2 A T 10: 19,626,699 N89Y probably damaging Het
Itgb6 T C 2: 60,653,281 D261G probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kif1a T A 1: 93,066,149 I360F probably damaging Het
Kmt2d T C 15: 98,862,985 Q828R unknown Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mios T A 6: 8,216,385 Y436* probably null Het
Mprip C T 11: 59,755,041 L684F probably damaging Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Naga C T 15: 82,337,468 R24Q probably benign Het
Nr2c1 G A 10: 94,163,786 V103M possibly damaging Het
Oca2 A G 7: 56,254,980 S65G possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr598 A G 7: 103,328,647 I54V probably benign Het
Phyhipl A T 10: 70,599,025 I28N probably benign Het
Pik3cb C A 9: 99,101,289 E89* probably null Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Ppm1a T A 12: 72,793,707 probably null Het
Relt T C 7: 100,850,194 I173V probably damaging Het
Rfx7 T A 9: 72,619,637 S1370T possibly damaging Het
Rps7 G A 12: 28,634,259 R81C probably benign Het
Saa3 T C 7: 46,712,126 *123W probably null Het
Serpina3b C A 12: 104,138,637 H357Q probably damaging Het
Slc9c1 T A 16: 45,558,281 N493K probably benign Het
Spata31 T C 13: 64,922,383 Y782H probably benign Het
Tfap2a T C 13: 40,725,170 D166G probably damaging Het
Thada A T 17: 84,464,407 M9K probably benign Het
Tmem269 A T 4: 119,210,873 probably null Het
Tnxb C A 17: 34,703,889 P2482Q probably damaging Het
Vit T C 17: 78,605,511 V291A possibly damaging Het
Zfp930 G T 8: 69,226,394 A18S possibly damaging Het
Zufsp A T 10: 33,943,718 V200D probably damaging Het
Other mutations in Pifo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pifo APN 3 106014508 missense probably benign 0.29
IGL01615:Pifo APN 3 105997207 splice site probably null
IGL02451:Pifo APN 3 106014504 missense probably benign 0.09
R0139:Pifo UTSW 3 105999570 missense possibly damaging 0.46
R1832:Pifo UTSW 3 106014596 missense possibly damaging 0.53
R4404:Pifo UTSW 3 106001368 missense probably benign 0.25
R4681:Pifo UTSW 3 105998385 missense probably damaging 1.00
R4984:Pifo UTSW 3 106001494 start gained probably benign
R5245:Pifo UTSW 3 106014454 missense possibly damaging 0.92
R5308:Pifo UTSW 3 106001103 missense probably benign 0.02
R6015:Pifo UTSW 3 105999621 missense possibly damaging 0.47
R7430:Pifo UTSW 3 106014518 missense probably benign
R8253:Pifo UTSW 3 105998367 missense probably benign
Z1177:Pifo UTSW 3 105999605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGAGCTCTATCCTGCC -3'
(R):5'- ATACCACAGTGCTGCTTTGC -3'

Sequencing Primer
(F):5'- TACCAGGAAGGGGGTAGTTTCC -3'
(R):5'- TGCTTTGCAGAAAACCATGTC -3'
Posted On2014-06-23