Incidental Mutation 'R1802:Mios'
ID203207
Institutional Source Beutler Lab
Gene Symbol Mios
Ensembl Gene ENSMUSG00000042447
Gene Namemeiosis regulator for oocyte development
Synonyms
MMRRC Submission 039832-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R1802 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location8209222-8236274 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 8216385 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 436 (Y436*)
Ref Sequence ENSEMBL: ENSMUSP00000039301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040017]
Predicted Effect probably null
Transcript: ENSMUST00000040017
AA Change: Y436*
SMART Domains Protein: ENSMUSP00000039301
Gene: ENSMUSG00000042447
AA Change: Y436*

DomainStartEndE-ValueType
Blast:WD40 49 91 2e-18 BLAST
WD40 101 146 2.05e1 SMART
WD40 174 212 3.55e1 SMART
WD40 214 252 2.45e2 SMART
WD40 256 297 6.42e-1 SMART
Blast:WD40 312 354 2e-13 BLAST
Pfam:zinc_ribbon_16 737 861 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik T A 11: 101,988,476 Y25N possibly damaging Het
Abcd2 G T 15: 91,163,102 R583S probably benign Het
Ago2 A T 15: 73,121,180 F492Y probably damaging Het
Ano4 T A 10: 88,981,016 D610V probably damaging Het
Atp6v0d2 A G 4: 19,922,366 probably null Het
Atxn7 T G 14: 14,089,419 S312A probably benign Het
Azgp1 A G 5: 137,985,231 Y56C probably damaging Het
Bcan A G 3: 87,993,108 V606A possibly damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
Ccdc63 T C 5: 122,129,877 R9G probably damaging Het
Cdyl T A 13: 35,872,636 L534* probably null Het
Celf2 T C 2: 6,549,933 E445G probably damaging Het
Cnot8 T C 11: 58,117,535 C276R probably benign Het
Dock4 A G 12: 40,794,598 I1135V possibly damaging Het
Edc3 A G 9: 57,727,315 D205G probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Fancl T G 11: 26,459,709 S188R probably benign Het
Fbn2 T A 18: 58,052,976 K1767* probably null Het
Glrb A T 3: 80,861,957 H154Q probably damaging Het
Gm19965 C T 1: 116,820,903 R105* probably null Het
Grhpr C A 4: 44,988,950 Y202* probably null Het
Herc2 A G 7: 56,184,332 E3095G probably damaging Het
Il22ra2 A T 10: 19,626,699 N89Y probably damaging Het
Itgb6 T C 2: 60,653,281 D261G probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kif1a T A 1: 93,066,149 I360F probably damaging Het
Kmt2d T C 15: 98,862,985 Q828R unknown Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mprip C T 11: 59,755,041 L684F probably damaging Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Naga C T 15: 82,337,468 R24Q probably benign Het
Nr2c1 G A 10: 94,163,786 V103M possibly damaging Het
Oca2 A G 7: 56,254,980 S65G possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr598 A G 7: 103,328,647 I54V probably benign Het
Phyhipl A T 10: 70,599,025 I28N probably benign Het
Pifo T A 3: 106,014,550 Q19L possibly damaging Het
Pik3cb C A 9: 99,101,289 E89* probably null Het
Plekhm2 A T 4: 141,634,347 S262T probably benign Het
Ppm1a T A 12: 72,793,707 probably null Het
Relt T C 7: 100,850,194 I173V probably damaging Het
Rfx7 T A 9: 72,619,637 S1370T possibly damaging Het
Rps7 G A 12: 28,634,259 R81C probably benign Het
Saa3 T C 7: 46,712,126 *123W probably null Het
Serpina3b C A 12: 104,138,637 H357Q probably damaging Het
Slc9c1 T A 16: 45,558,281 N493K probably benign Het
Spata31 T C 13: 64,922,383 Y782H probably benign Het
Tfap2a T C 13: 40,725,170 D166G probably damaging Het
Thada A T 17: 84,464,407 M9K probably benign Het
Tmem269 A T 4: 119,210,873 probably null Het
Tnxb C A 17: 34,703,889 P2482Q probably damaging Het
Vit T C 17: 78,605,511 V291A possibly damaging Het
Zfp930 G T 8: 69,226,394 A18S possibly damaging Het
Zufsp A T 10: 33,943,718 V200D probably damaging Het
Other mutations in Mios
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Mios APN 6 8234363 critical splice donor site probably null
IGL01365:Mios APN 6 8216089 nonsense probably null
IGL01548:Mios APN 6 8234252 missense possibly damaging 0.90
IGL01898:Mios APN 6 8222668 missense probably benign 0.03
IGL02110:Mios APN 6 8215565 missense probably damaging 1.00
IGL02308:Mios APN 6 8231269 missense probably benign 0.06
IGL02375:Mios APN 6 8222598 missense probably benign 0.02
IGL02452:Mios APN 6 8222492 missense probably benign 0.01
IGL02670:Mios APN 6 8235378 splice site probably benign
IGL03083:Mios APN 6 8215156 missense probably damaging 1.00
R0462:Mios UTSW 6 8215743 missense probably benign 0.11
R0591:Mios UTSW 6 8215470 missense possibly damaging 0.52
R1351:Mios UTSW 6 8228120 missense possibly damaging 0.70
R1476:Mios UTSW 6 8234237 missense probably benign 0.01
R1959:Mios UTSW 6 8215437 missense probably benign 0.17
R1964:Mios UTSW 6 8215798 missense probably damaging 0.99
R2272:Mios UTSW 6 8226865 missense possibly damaging 0.71
R2915:Mios UTSW 6 8214935 missense possibly damaging 0.72
R3852:Mios UTSW 6 8216453 missense probably benign 0.09
R3876:Mios UTSW 6 8233189 missense probably damaging 0.98
R3948:Mios UTSW 6 8215496 missense probably benign
R4698:Mios UTSW 6 8228113 missense possibly damaging 0.60
R4785:Mios UTSW 6 8222464 missense probably benign
R4789:Mios UTSW 6 8235429 missense probably benign 0.06
R4866:Mios UTSW 6 8214857 missense probably damaging 1.00
R4878:Mios UTSW 6 8215094 missense probably benign 0.00
R4991:Mios UTSW 6 8215847 missense probably benign 0.00
R5479:Mios UTSW 6 8215314 missense probably benign 0.00
R5714:Mios UTSW 6 8215434 missense probably damaging 0.99
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6030:Mios UTSW 6 8215704 missense probably benign 0.11
R6111:Mios UTSW 6 8214836 missense probably benign 0.01
R6455:Mios UTSW 6 8231239 missense probably benign 0.03
R7381:Mios UTSW 6 8216064 missense probably damaging 0.98
R8350:Mios UTSW 6 8227998 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCAAATTGGGTAGCATGC -3'
(R):5'- TGACATTTCTGTACAGTCCTGAAC -3'

Sequencing Primer
(F):5'- GCAAATTGGGTAGCATGCTAAATG -3'
(R):5'- GGAATTTTCTTACCCAAAGATG -3'
Posted On2014-06-23