Incidental Mutation 'R0113:Gm5155'
ID20580
Institutional Source Beutler Lab
Gene Symbol Gm5155
Ensembl Gene ENSMUSG00000078793
Gene Namepredicted gene 5155
Synonyms
MMRRC Submission 038399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0113 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location17871768-17919024 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to A at 17908948 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072381
SMART Domains Protein: ENSMUSP00000072218
Gene: ENSMUSG00000078793

DomainStartEndE-ValueType
IG 40 141 2.27e-2 SMART
IG_like 160 261 2.73e1 SMART
IG_like 277 378 6.69e0 SMART
IG_like 397 498 4.07e1 SMART
IG_like 514 615 6.52e0 SMART
IG_like 634 735 1.05e1 SMART
IG 753 853 1.28e-1 SMART
IGc2 869 933 3.82e-9 SMART
Meta Mutation Damage Score 0.1275 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 95.2%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik A G 8: 10,926,126 noncoding transcript Het
4930432K21Rik C T 8: 84,167,242 T311I probably damaging Het
Abca13 A T 11: 9,292,114 I1326F possibly damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Aspscr1 C G 11: 120,688,925 Q97E probably damaging Het
Atad2 A G 15: 58,120,934 probably benign Het
Atcay A T 10: 81,214,720 probably null Het
C4b T A 17: 34,741,240 Y279F probably damaging Het
Cav1 A T 6: 17,308,049 S67C possibly damaging Het
Celf2 A C 2: 6,624,714 H113Q probably damaging Het
Cep170 A C 1: 176,758,455 N590K probably damaging Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chrna1 C A 2: 73,566,836 D370Y possibly damaging Het
Csmd1 C A 8: 15,984,849 G2441C probably damaging Het
D630003M21Rik C T 2: 158,196,575 D984N possibly damaging Het
Dhrs1 T C 14: 55,739,939 T241A probably benign Het
Edar A C 10: 58,629,449 C31G probably damaging Het
Eps8 A G 6: 137,537,684 S24P possibly damaging Het
Fam149a T C 8: 45,341,024 E669G probably damaging Het
Fcrla A T 1: 170,922,299 M1K probably null Het
G3bp1 T A 11: 55,495,426 V237E probably benign Het
Galnt5 A G 2: 57,998,877 E163G probably benign Het
Gpr87 T C 3: 59,179,511 D192G possibly damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Ints1 T C 5: 139,765,213 T810A Het
Kalrn A G 16: 34,049,936 probably benign Het
Kcnk6 T C 7: 29,232,209 D92G probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mfsd6 A T 1: 52,709,189 N172K probably damaging Het
Mtcl1 G T 17: 66,354,242 Q1225K possibly damaging Het
Nav2 C T 7: 49,535,953 T948M probably damaging Het
Nfic T C 10: 81,420,585 K104E probably damaging Het
Nupl1 G A 14: 60,251,291 probably benign Het
Nwd2 A T 5: 63,807,898 K1608N probably damaging Het
Olfr148 T A 9: 39,614,002 I145K probably benign Het
Olfr50 G A 2: 36,793,994 G253R probably damaging Het
Olfr50 G T 2: 36,793,995 G253V probably damaging Het
Phf21b T C 15: 84,804,767 D186G probably damaging Het
Poli C T 18: 70,528,758 C57Y probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Psg23 T C 7: 18,612,002 Y256C probably benign Het
Satb1 C A 17: 51,782,698 E374* probably null Het
Scn4a C T 11: 106,345,436 E333K probably benign Het
Sec14l2 C T 11: 4,103,661 probably benign Het
Slain1 T C 14: 103,685,825 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syne2 T C 12: 75,930,578 S1266P probably damaging Het
Syne2 A G 12: 76,033,722 E4810G probably damaging Het
Tbck T C 3: 132,743,080 I618T probably damaging Het
Tmem132d A T 5: 127,784,593 N821K probably benign Het
Trim28 T A 7: 13,028,701 V381E probably damaging Het
Ttc1 T C 11: 43,745,288 S43G probably benign Het
Ube2u A G 4: 100,481,655 E39G possibly damaging Het
Urb2 T C 8: 124,030,926 V1124A probably benign Het
Usp13 A G 3: 32,817,876 probably benign Het
Vmn1r216 A T 13: 23,099,461 S105C probably damaging Het
Yipf2 T C 9: 21,590,116 T23A probably damaging Het
Zfp521 G A 18: 13,845,091 T755M probably damaging Het
Zfp619 T A 7: 39,537,759 M1071K probably benign Het
Zfp942 A T 17: 21,929,085 C188S probably benign Het
Other mutations in Gm5155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Gm5155 APN 7 17910697 missense probably benign 0.32
IGL01085:Gm5155 APN 7 17915691 missense possibly damaging 0.71
IGL01135:Gm5155 APN 7 17902471 exon noncoding transcript
IGL01291:Gm5155 APN 7 17905116 exon noncoding transcript
IGL02252:Gm5155 APN 7 17910532 missense possibly damaging 0.93
IGL03243:Gm5155 APN 7 17918649 exon noncoding transcript
R0833:Gm5155 UTSW 7 17904981 missense possibly damaging 0.95
R0836:Gm5155 UTSW 7 17904981 missense possibly damaging 0.95
R1462:Gm5155 UTSW 7 17915591 exon noncoding transcript
R1473:Gm5155 UTSW 7 17905091 exon noncoding transcript
R1817:Gm5155 UTSW 7 17873330 exon noncoding transcript
R1905:Gm5155 UTSW 7 17873552 exon noncoding transcript
R2362:Gm5155 UTSW 7 17902473 exon noncoding transcript
R3721:Gm5155 UTSW 7 17902738 missense probably benign 0.41
R4305:Gm5155 UTSW 7 17905193 missense probably benign 0.19
R4567:Gm5155 UTSW 7 17908966 missense probably damaging 0.97
R4587:Gm5155 UTSW 7 17886224 missense possibly damaging 0.47
R4691:Gm5155 UTSW 7 17908966 missense possibly damaging 0.93
R4989:Gm5155 UTSW 7 17905218 splice site probably null
R5023:Gm5155 UTSW 7 17902706 missense probably damaging 1.00
R5024:Gm5155 UTSW 7 17910682 missense probably benign 0.06
R5274:Gm5155 UTSW 7 17915717 splice site probably null
R5279:Gm5155 UTSW 7 17873289 splice site noncoding transcript
R5304:Gm5155 UTSW 7 17902692 missense probably benign 0.06
R5312:Gm5155 UTSW 7 17909142 missense probably damaging 1.00
R5899:Gm5155 UTSW 7 17917444 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTTGACACCCAAGTAGAGAGCACC -3'
(R):5'- TGACAATCCTGTGAGTCTGAGCCC -3'

Sequencing Primer
(F):5'- GGAAGATACTTCCTCCACAGTTAGG -3'
(R):5'- GAGAACCACTTACTGTCCAGC -3'
Posted On2013-04-11