Incidental Mutation 'R9484:Gabrr2'
ID 716424
Institutional Source Beutler Lab
Gene Symbol Gabrr2
Ensembl Gene ENSMUSG00000023267
Gene Name gamma-aminobutyric acid (GABA) C receptor, subunit rho 2
Synonyms
Accession Numbers

Genbank: NM_008076; MGI: 95626; Ensembl: ENSMUST00000108162, ENSMUST00000147889, ENSMUST00000131920, ENSMUST00000024035

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9484 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 33062999-33095865 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33071352 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 64 (H64R)
Ref Sequence ENSEMBL: ENSMUSP00000024035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024035] [ENSMUST00000108162]
AlphaFold P56476
Predicted Effect possibly damaging
Transcript: ENSMUST00000024035
AA Change: H64R

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024035
Gene: ENSMUSG00000023267
AA Change: H64R

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 81 286 3.4e-53 PFAM
Pfam:Neur_chan_memb 293 454 1.9e-32 PFAM
transmembrane domain 472 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108162
AA Change: H39R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103797
Gene: ENSMUSG00000023267
AA Change: H39R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 57 261 9.7e-57 PFAM
Pfam:Neur_chan_memb 268 414 4.2e-36 PFAM
transmembrane domain 447 464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.2%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. The protein encoded by this gene is a member of the rho subunit family and is a component of the GABA type A receptor complex. This gene exists on chromosome 6q next to the gene encoding the rho 1 subunit of the GABA type A receptor, in a region thought to be associated with susceptibility for psychiatric disorders and epilepsy. Polymorphisms in this gene may also be associated with alcohol dependence, and general cognitive ability. [provided by RefSeq, Apr 2016]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,112,786 C151S probably damaging Het
Actr8 T C 14: 29,986,344 I193T probably benign Het
Btbd2 T C 10: 80,644,269 N419S probably benign Het
Cacna2d1 T A 5: 16,356,833 W821R probably damaging Het
Cadps2 T C 6: 23,626,647 Y214C probably benign Het
Calu T A 6: 29,366,163 L180Q probably damaging Het
Corin C T 5: 72,339,937 V615I probably damaging Het
Cyp8b1 A T 9: 121,915,917 D116E probably benign Het
D630036H23Rik C A 12: 36,381,712 A96S unknown Het
Ddx24 A T 12: 103,411,296 Y717N probably damaging Het
Dmap1 G T 4: 117,676,111 Q249K probably benign Het
Dnah10 T A 5: 124,823,444 W3922R probably damaging Het
Dnah14 T C 1: 181,690,208 F2036L probably benign Het
Dnah14 T C 1: 181,797,746 I4064T probably benign Het
Dock9 A C 14: 121,581,432 V1546G probably damaging Het
Eif3a A T 19: 60,766,568 S1059T unknown Het
Ep300 A G 15: 81,636,825 E1262G unknown Het
Evl T A 12: 108,686,457 I387N probably damaging Het
Fat2 A C 11: 55,309,926 V774G probably damaging Het
Fez1 T A 9: 36,843,797 Y31N probably benign Het
Fkbp10 A G 11: 100,423,134 I435V probably damaging Het
Flnb A G 14: 7,929,004 D1911G probably benign Het
Fnbp1 T C 2: 31,083,026 Y154C probably benign Het
Fndc10 T C 4: 155,695,039 I180T possibly damaging Het
Frmd4a G A 2: 4,604,215 V965I possibly damaging Het
Glis3 T C 19: 28,531,003 D527G probably damaging Het
Gm2022 A T 12: 87,895,479 Q37L possibly damaging Het
H2-Ob T A 17: 34,241,015 F33L probably damaging Het
Hbb-bh1 C T 7: 103,843,032 E27K probably benign Het
Ifnb1 T A 4: 88,522,678 T33S probably benign Het
Igkv4-80 T A 6: 69,016,782 T42S probably damaging Het
Irs2 C T 8: 11,007,334 G366D probably damaging Het
Kcnk2 CAAA CAA 1: 189,256,694 probably null Het
Krtap5-3 T A 7: 142,202,331 C302S unknown Het
Lgi1 A G 19: 38,306,309 K510E probably benign Het
Lgi2 T A 5: 52,538,594 D341V probably benign Het
Lin7c T C 2: 109,894,468 I14T probably benign Het
Lrrc19 A T 4: 94,643,336 M13K probably benign Het
Lrrc69 T C 4: 14,666,012 I315M probably benign Het
Myo5c A T 9: 75,297,488 D1541V probably damaging Het
Mypn T G 10: 63,167,240 M373L probably benign Het
Nckipsd C A 9: 108,812,638 H333N probably damaging Het
Nrg2 A T 18: 36,024,348 L428Q probably null Het
Olfr1367 C A 13: 21,347,417 T163K probably damaging Het
Olfr235 T C 19: 12,268,371 I47T possibly damaging Het
Olfr53 T C 7: 140,651,991 L4S probably benign Het
Otogl T A 10: 107,822,033 probably null Het
Otogl C T 10: 107,901,295 G86D probably damaging Het
Papln A T 12: 83,791,844 Q1249L probably benign Het
Plxna2 G T 1: 194,644,894 G379C probably damaging Het
Pofut2 T C 10: 77,259,426 I35T probably benign Het
Pros1 A G 16: 62,924,524 T501A possibly damaging Het
Rapgef1 T C 2: 29,735,809 S1042P possibly damaging Het
Rps6kb1 C T 11: 86,517,617 E185K probably damaging Het
Slc13a2 A T 11: 78,403,407 L216Q probably damaging Het
Slc22a14 T C 9: 119,180,549 Y160C probably damaging Het
Slc22a4 T A 11: 53,988,947 I429F possibly damaging Het
Slc26a3 A G 12: 31,461,786 K457E probably damaging Het
Slc47a2 T C 11: 61,336,234 I169M possibly damaging Het
Slco1a1 C T 6: 141,908,946 V660I probably benign Het
Smyd1 A G 6: 71,225,466 Y252H probably damaging Het
Soga3 G A 10: 29,196,973 D754N probably damaging Het
Spp2 A T 1: 88,406,973 probably benign Het
Stra8 T A 6: 34,934,186 W250R probably damaging Het
Syne1 A C 10: 5,220,359 L5183R probably damaging Het
Tdrd9 T C 12: 112,046,250 S1203P probably damaging Het
Th C A 7: 142,899,883 E27* probably null Het
Thada C A 17: 84,429,191 L887F probably damaging Het
Timm23 T C 14: 32,180,629 T186A probably benign Het
Tmem132b A T 5: 125,783,356 E555V probably damaging Het
Tnik A T 3: 28,594,944 Q457L unknown Het
Uba7 C A 9: 107,983,838 H942Q probably benign Het
Upf2 T C 2: 5,961,267 S233P unknown Het
Urm1 T A 2: 29,842,748 N72K probably damaging Het
Usp10 T C 8: 119,948,765 S508P possibly damaging Het
Usp37 G A 1: 74,459,922 P632S probably damaging Het
Wdr77 T A 3: 105,965,088 N209K probably benign Het
Zbtb24 C T 10: 41,451,433 T105M probably benign Het
Zfp341 T A 2: 154,643,843 I671N probably damaging Het
Zfp414 A G 17: 33,630,010 T73A probably benign Het
Zfp574 A T 7: 25,081,979 I809F possibly damaging Het
Zfp62 T C 11: 49,217,281 I733T probably damaging Het
Zfp719 A G 7: 43,590,157 I390V possibly damaging Het
Other mutations in Gabrr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Gabrr2 APN 4 33085626 missense probably damaging 1.00
IGL02070:Gabrr2 APN 4 33095340 nonsense probably null
IGL03283:Gabrr2 APN 4 33082364 splice site probably benign
D3080:Gabrr2 UTSW 4 33084466 missense probably damaging 1.00
R1250:Gabrr2 UTSW 4 33063273 missense probably benign 0.20
R1381:Gabrr2 UTSW 4 33081420 missense probably damaging 1.00
R1630:Gabrr2 UTSW 4 33085647 missense probably damaging 1.00
R1782:Gabrr2 UTSW 4 33085593 missense probably damaging 1.00
R1830:Gabrr2 UTSW 4 33077481 missense probably damaging 1.00
R2000:Gabrr2 UTSW 4 33084400 missense probably damaging 1.00
R2125:Gabrr2 UTSW 4 33095548 missense probably damaging 1.00
R2679:Gabrr2 UTSW 4 33071435 missense probably damaging 1.00
R3695:Gabrr2 UTSW 4 33071430 missense probably damaging 1.00
R3891:Gabrr2 UTSW 4 33081348 missense probably damaging 1.00
R3892:Gabrr2 UTSW 4 33081348 missense probably damaging 1.00
R4902:Gabrr2 UTSW 4 33095512 missense probably damaging 1.00
R5328:Gabrr2 UTSW 4 33082565 missense probably damaging 1.00
R5330:Gabrr2 UTSW 4 33082583 missense possibly damaging 0.87
R5331:Gabrr2 UTSW 4 33082583 missense possibly damaging 0.87
R5399:Gabrr2 UTSW 4 33071458 critical splice donor site probably null
R7299:Gabrr2 UTSW 4 33095284 missense probably benign 0.02
R7301:Gabrr2 UTSW 4 33095284 missense probably benign 0.02
R7605:Gabrr2 UTSW 4 33082560 missense probably damaging 1.00
R7697:Gabrr2 UTSW 4 33071358 missense probably benign
R7860:Gabrr2 UTSW 4 33081470 nonsense probably null
R7957:Gabrr2 UTSW 4 33081410 missense probably damaging 0.99
R8161:Gabrr2 UTSW 4 33082566 missense probably damaging 1.00
R8185:Gabrr2 UTSW 4 33082330 missense probably damaging 1.00
R8463:Gabrr2 UTSW 4 33084375 missense probably damaging 1.00
R8700:Gabrr2 UTSW 4 33095488 missense probably damaging 0.97
R8778:Gabrr2 UTSW 4 33095517 missense probably damaging 1.00
R9137:Gabrr2 UTSW 4 33095571 missense probably benign 0.36
R9366:Gabrr2 UTSW 4 33085771 missense
R9528:Gabrr2 UTSW 4 33081483 missense probably benign 0.01
R9704:Gabrr2 UTSW 4 33063305 missense possibly damaging 0.58
X0017:Gabrr2 UTSW 4 33082328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGAATGTTCTGGAAGGATC -3'
(R):5'- TGTCAACAGCCTCTCCACTG -3'

Sequencing Primer
(F):5'- AATGTTCTGGAAGGATCTGTCC -3'
(R):5'- ACTGCCTGCCTGTGACCAC -3'
Posted On 2022-07-18