Incidental Mutation 'R1916:Olfr1261'
ID214832
Institutional Source Beutler Lab
Gene Symbol Olfr1261
Ensembl Gene ENSMUSG00000061295
Gene Nameolfactory receptor 1261
SynonymsGA_x6K02T2Q125-51425355-51426275, MOR234-3
MMRRC Submission 039934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R1916 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89991221-89996189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89993804 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 137 (V137A)
Ref Sequence ENSEMBL: ENSMUSP00000150711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077785] [ENSMUST00000111509] [ENSMUST00000213909] [ENSMUST00000216953]
Predicted Effect probably benign
Transcript: ENSMUST00000077785
AA Change: V137A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076959
Gene: ENSMUSG00000061295
AA Change: V137A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 297 1.5e-6 PFAM
Pfam:7tm_1 36 282 4.5e-26 PFAM
Pfam:7tm_4 134 275 4.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111509
SMART Domains Protein: ENSMUSP00000107134
Gene: ENSMUSG00000061295

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 1.8e-41 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.5e-6 PFAM
Pfam:7tm_1 36 282 4.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213909
AA Change: V137A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216953
AA Change: V137A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,768,475 T588A probably damaging Het
Abca13 G T 11: 9,534,456 W4342L probably damaging Het
Abcg8 A T 17: 84,688,530 probably null Het
Acaa1b A G 9: 119,156,662 L65P probably damaging Het
Adam6a G T 12: 113,545,936 R643L probably benign Het
Agbl2 A T 2: 90,815,441 R839S possibly damaging Het
Ambra1 A T 2: 91,911,461 N967I probably damaging Het
Ankrd17 T A 5: 90,260,141 N1406Y probably damaging Het
Bbx G T 16: 50,266,245 S96Y probably damaging Het
Casc1 A C 6: 145,176,200 V631G probably benign Het
Cdh12 T A 15: 21,520,250 probably null Het
Cdh9 A C 15: 16,823,275 R114S probably benign Het
Cenpo T G 12: 4,216,683 I142L probably benign Het
Cfap69 T C 5: 5,663,970 K21E probably damaging Het
Chmp4c A T 3: 10,389,936 D221V probably benign Het
Cstf3 T A 2: 104,655,756 V447D possibly damaging Het
Cwc22 A T 2: 77,905,475 C566S probably benign Het
Dgkh A G 14: 78,595,223 M798T probably damaging Het
Dnaic2 T C 11: 114,732,923 V4A possibly damaging Het
Dnmbp T G 19: 43,901,568 I587L possibly damaging Het
Dock6 A T 9: 21,813,091 M301K probably damaging Het
Dock8 T C 19: 25,061,157 M69T probably benign Het
Ears2 T C 7: 122,044,578 S386G probably benign Het
Ecsit T C 9: 22,072,521 I371V probably benign Het
Eif4a3 T C 11: 119,293,911 I216V probably benign Het
Emp1 A G 6: 135,380,130 I69V probably damaging Het
Epg5 A G 18: 77,965,021 D788G probably benign Het
Eps15 A G 4: 109,368,974 K324E probably damaging Het
Extl3 A G 14: 65,077,622 F37S probably benign Het
Fam83g A G 11: 61,695,168 D194G probably damaging Het
Gcc2 A G 10: 58,276,663 D1005G probably damaging Het
Gm10226 T A 17: 21,692,009 H50Q possibly damaging Het
Gm1110 A T 9: 26,889,638 V420E probably damaging Het
Gm16503 A G 4: 147,541,210 R54G unknown Het
Gm5538 A G 3: 59,745,503 K121R possibly damaging Het
Grasp T C 15: 101,226,969 probably benign Het
Grin3b T C 10: 79,974,598 M646T probably damaging Het
Grm8 T C 6: 27,363,584 D644G probably benign Het
Gtf2i C A 5: 134,246,848 V660F probably damaging Het
Heatr4 G T 12: 83,955,817 Q808K probably benign Het
Hif3a T C 7: 17,039,656 S573G possibly damaging Het
Htr2b C T 1: 86,099,801 V328M probably damaging Het
Jph1 T C 1: 17,092,055 T128A probably damaging Het
Kcnt1 T C 2: 25,900,469 V481A probably damaging Het
Khk A G 5: 30,930,618 Y212C probably damaging Het
Lgi2 T A 5: 52,546,632 Q219L probably benign Het
Lipf T A 19: 33,965,675 Y128N probably benign Het
Lipg A G 18: 74,960,937 V13A probably benign Het
Lrrc8e T C 8: 4,235,202 S476P probably benign Het
Map2k7 T G 8: 4,245,795 V425G probably benign Het
Mycbp2 A T 14: 103,184,883 S2451R probably damaging Het
Mylk3 A G 8: 85,327,192 S629P probably damaging Het
Nrp2 A T 1: 62,762,747 I450F probably damaging Het
Olfr150 A G 9: 39,737,622 D269G probably benign Het
Osbpl11 T C 16: 33,185,843 S14P probably benign Het
Osbpl11 T A 16: 33,210,095 V231D possibly damaging Het
Parg T A 14: 32,208,227 probably benign Het
Pax9 G T 12: 56,697,138 R190L possibly damaging Het
Prss12 G A 3: 123,506,495 V752I probably benign Het
Pstpip2 A G 18: 77,835,192 N34S probably damaging Het
Rarg T C 15: 102,252,445 D53G probably benign Het
Rbak T C 5: 143,176,116 K53R probably damaging Het
Scgn A T 13: 23,978,825 S107R probably damaging Het
Sema3c A G 5: 17,727,401 Q634R probably benign Het
Serpinh1 A G 7: 99,349,081 L114P probably damaging Het
Slc35f4 T C 14: 49,303,923 probably benign Het
Sned1 A T 1: 93,274,162 I617F probably null Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Spen A G 4: 141,472,598 L2883P probably damaging Het
Stmn3 A T 2: 181,307,280 M140K possibly damaging Het
Syn3 A G 10: 86,354,344 probably null Het
Tor4a A G 2: 25,195,402 V163A possibly damaging Het
Ttc12 A G 9: 49,460,398 Y189H probably damaging Het
Ubxn7 T G 16: 32,381,759 probably benign Het
Unc5b G A 10: 60,778,248 T274I probably damaging Het
Upk1b C A 16: 38,776,186 probably null Het
Usp18 A G 6: 121,268,554 I296M probably benign Het
Usp42 A G 5: 143,715,056 Y1071H probably damaging Het
Vil1 A G 1: 74,418,525 T106A probably benign Het
Vmn1r42 T A 6: 89,844,967 I207F probably benign Het
Vmn1r63 A G 7: 5,803,226 F136L probably damaging Het
Vopp1 C T 6: 57,754,587 V140I probably benign Het
Wdhd1 T C 14: 47,258,577 D610G possibly damaging Het
Wdr48 T A 9: 119,912,417 D142E probably benign Het
Whrn A G 4: 63,494,732 Y10H probably damaging Het
Zmat3 A G 3: 32,343,348 V216A probably benign Het
Zmym2 C T 14: 56,959,842 R1356W probably damaging Het
Zyg11b A T 4: 108,272,283 L44Q probably damaging Het
Other mutations in Olfr1261
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02582:Olfr1261 APN 2 89994312 missense probably benign 0.00
R0140:Olfr1261 UTSW 2 89994119 missense probably damaging 1.00
R0220:Olfr1261 UTSW 2 89993862 missense probably benign 0.08
R0243:Olfr1261 UTSW 2 89993806 missense probably benign 0.01
R1644:Olfr1261 UTSW 2 89993953 missense possibly damaging 0.60
R1669:Olfr1261 UTSW 2 89993800 splice site probably null
R3620:Olfr1261 UTSW 2 89993852 missense probably damaging 1.00
R4190:Olfr1261 UTSW 2 89993574 nonsense probably null
R5260:Olfr1261 UTSW 2 89994182 missense probably damaging 1.00
R5591:Olfr1261 UTSW 2 89993407 missense possibly damaging 0.95
R5907:Olfr1261 UTSW 2 89993957 missense probably benign 0.01
R5910:Olfr1261 UTSW 2 89993438 missense probably benign 0.29
R6044:Olfr1261 UTSW 2 89993417 missense possibly damaging 0.89
R6556:Olfr1261 UTSW 2 89994173 missense probably benign 0.39
R7083:Olfr1261 UTSW 2 89993857 missense probably benign
R7439:Olfr1261 UTSW 2 89993839 missense probably benign 0.00
R8439:Olfr1261 UTSW 2 89994004 missense probably benign 0.31
R8745:Olfr1261 UTSW 2 89993732 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTCTGAGAAGAGCACCATATC -3'
(R):5'- TTCTCAGGGAGCGAAGGATG -3'

Sequencing Primer
(F):5'- GAGCACCATATCCTTCAATGGCTG -3'
(R):5'- TGAGTAAACACAGTGACCCGCTG -3'
Posted On2014-07-14