Incidental Mutation 'R1971:Tbc1d9'
ID220883
Institutional Source Beutler Lab
Gene Symbol Tbc1d9
Ensembl Gene ENSMUSG00000031709
Gene NameTBC1 domain family, member 9
Synonyms4933431N12Rik, C76116
MMRRC Submission 039984-MU
Accession Numbers

Genbank: NM_001111304.1, NM_027758.4

Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R1971 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83165352-83272934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83249510 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 566 (R566H)
Ref Sequence ENSEMBL: ENSMUSP00000091093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034145] [ENSMUST00000093393]
Predicted Effect unknown
Transcript: ENSMUST00000034145
AA Change: R333H
SMART Domains Protein: ENSMUSP00000034145
Gene: ENSMUSG00000031709
AA Change: R333H

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
low complexity region 192 208 N/A INTRINSIC
TBC 279 492 8.68e-56 SMART
Blast:TBC 500 587 5e-35 BLAST
PDB:1BJF|B 579 703 3e-7 PDB
low complexity region 917 937 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093393
AA Change: R566H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091093
Gene: ENSMUSG00000031709
AA Change: R566H

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
GRAM 146 213 1.2e-25 SMART
low complexity region 267 278 N/A INTRINSIC
GRAM 293 361 1.37e-20 SMART
low complexity region 425 441 N/A INTRINSIC
TBC 512 725 8.68e-56 SMART
Blast:TBC 733 820 6e-35 BLAST
PDB:1BJF|B 812 936 4e-7 PDB
low complexity region 1150 1170 N/A INTRINSIC
Meta Mutation Damage Score 0.8669 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (115/116)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,796,554 I242N probably benign Het
2510009E07Rik G T 16: 21,653,298 Y217* probably null Het
4931429L15Rik C T 9: 46,308,788 V149M probably benign Het
9030624J02Rik A C 7: 118,775,334 R352S probably damaging Het
9530053A07Rik C A 7: 28,131,512 A50E possibly damaging Het
Abcg8 G T 17: 84,695,159 probably benign Het
Acox1 A G 11: 116,198,261 F77S probably benign Het
Adgrb3 G T 1: 25,547,444 H389Q probably benign Het
Ak7 A G 12: 105,726,245 N186S probably damaging Het
Apobr A G 7: 126,586,225 T303A probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Bcl9l T C 9: 44,508,699 probably null Het
Bco2 T C 9: 50,545,984 D86G probably damaging Het
Bmpr1b T A 3: 141,857,572 I204F probably damaging Het
Bpifb5 C A 2: 154,230,344 Q324K probably benign Het
Cacna2d2 G A 9: 107,512,006 V223I probably damaging Het
Capn3 A G 2: 120,480,747 D105G possibly damaging Het
Ccdc40 G T 11: 119,263,075 probably null Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Ckap2l A G 2: 129,285,422 S279P possibly damaging Het
Cldn12 C A 5: 5,508,137 A97S probably benign Het
Clec2l T G 6: 38,663,374 S47A probably benign Het
Csnk1d C A 11: 120,972,448 R222M possibly damaging Het
Ctnna1 T A 18: 35,154,527 D96E probably benign Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
D730048I06Rik T A 9: 35,789,013 H92L probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Dmtf1 T C 5: 9,148,989 E48G probably benign Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dpf3 T A 12: 83,325,035 probably null Het
Drd2 T C 9: 49,407,059 F434L probably damaging Het
En1 A G 1: 120,607,013 T344A unknown Het
Eri3 A G 4: 117,564,767 T81A probably benign Het
Fam20a T C 11: 109,685,411 Y174C probably damaging Het
Fam234a G C 17: 26,216,655 probably null Het
Fam76a A T 4: 132,903,983 I217N probably damaging Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Foxo3 A G 10: 42,197,262 S420P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gm136 T G 4: 34,755,986 D9A probably benign Het
Gstt2 G T 10: 75,832,665 T116N probably benign Het
Hs3st6 A G 17: 24,753,293 T70A probably benign Het
Hspa14 A G 2: 3,489,767 V461A possibly damaging Het
Itih5 A T 2: 10,238,568 D372V probably damaging Het
Kcna2 A T 3: 107,104,824 R240S probably damaging Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lap3 T C 5: 45,506,166 probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lpin1 A T 12: 16,580,723 L58H probably damaging Het
Map4k5 G T 12: 69,826,328 P468Q possibly damaging Het
Med31 G A 11: 72,215,418 probably benign Het
Mki67 A T 7: 135,713,959 probably null Het
Mrc1 G A 2: 14,244,292 probably null Het
Msh3 A G 13: 92,223,276 I16T probably damaging Het
Msh3 T A 13: 92,249,820 probably benign Het
Mst1r A T 9: 107,913,212 I675F probably benign Het
Myb A C 10: 21,140,656 S652A probably benign Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Myl6b A G 10: 128,494,643 V181A probably damaging Het
Myt1l A T 12: 29,827,092 K247N unknown Het
Nanos2 G T 7: 18,987,704 V34L probably benign Het
Nav1 T C 1: 135,532,353 T411A probably benign Het
Nedd9 T A 13: 41,338,948 I23F probably damaging Het
Nes G A 3: 87,978,327 V1254I possibly damaging Het
Nol6 A G 4: 41,119,542 F588S probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1223 A T 2: 89,144,734 C96* probably null Het
Olfr390 T A 11: 73,787,790 M284K probably damaging Het
Olfr630 C T 7: 103,755,320 W88* probably null Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Olr1 T C 6: 129,493,535 E223G probably benign Het
Pclo A G 5: 14,713,473 T3987A unknown Het
Pik3cg A T 12: 32,192,153 V986D probably damaging Het
Pitpnm1 T A 19: 4,112,450 D1093E probably damaging Het
Ppp1r12b T C 1: 134,865,913 D571G probably benign Het
Rfx1 A G 8: 84,095,497 E875G probably damaging Het
Rnf145 T A 11: 44,548,815 I146N probably damaging Het
Rttn G A 18: 89,090,433 R1587H probably benign Het
Safb A G 17: 56,605,821 H883R probably benign Het
Sdhb A G 4: 140,972,949 D120G possibly damaging Het
Serpine3 A G 14: 62,665,084 N48S probably damaging Het
Sgms1 T A 19: 32,159,957 I70L probably benign Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Smtnl2 C T 11: 72,411,357 A93T probably benign Het
Srpr T C 9: 35,213,538 probably null Het
Taf6l A G 19: 8,775,502 probably null Het
Tbc1d10b A T 7: 127,207,864 V167E probably benign Het
Tenm3 A G 8: 48,236,313 Y2080H probably damaging Het
Tex14 A G 11: 87,511,605 N506S probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tjp1 G T 7: 65,324,078 T476K probably damaging Het
Tlr11 A T 14: 50,361,234 T226S probably benign Het
Tmem131 G A 1: 36,804,599 Q1394* probably null Het
Tmem161a C T 8: 70,176,909 R58W probably damaging Het
Tmem219 T C 7: 126,897,250 S13G probably benign Het
Trp53bp1 T C 2: 121,205,036 Y47C probably damaging Het
Ttn T A 2: 76,901,578 probably benign Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Usp37 A T 1: 74,439,968 Y948* probably null Het
Vav1 A T 17: 57,327,697 Y805F probably damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r2 T A 3: 64,126,700 Y467F probably damaging Het
Vps54 C A 11: 21,292,051 L389I probably damaging Het
Vwa8 G T 14: 78,925,254 probably benign Het
Wdr19 G T 5: 65,241,160 probably benign Het
Wnt2b A T 3: 104,954,617 probably benign Het
Xirp2 A G 2: 67,511,695 R1427G possibly damaging Het
Ylpm1 T C 12: 85,040,786 S1115P probably damaging Het
Zfp946 T A 17: 22,455,425 C387S probably damaging Het
Other mutations in Tbc1d9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tbc1d9 APN 8 83234162 missense probably damaging 1.00
IGL01443:Tbc1d9 APN 8 83239931 missense probably damaging 1.00
IGL01536:Tbc1d9 APN 8 83260992 missense probably damaging 1.00
IGL01811:Tbc1d9 APN 8 83233678 missense probably damaging 1.00
IGL02068:Tbc1d9 APN 8 83239868 missense probably damaging 1.00
IGL02938:Tbc1d9 APN 8 83269067 splice site probably benign
IGL02995:Tbc1d9 APN 8 83269059 critical splice donor site probably null
IGL03127:Tbc1d9 APN 8 83249473 missense probably damaging 1.00
IGL03128:Tbc1d9 APN 8 83166085 missense probably benign 0.01
H9600:Tbc1d9 UTSW 8 83210461 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0112:Tbc1d9 UTSW 8 83264837 splice site probably benign
R0525:Tbc1d9 UTSW 8 83268985 missense probably benign 0.08
R0528:Tbc1d9 UTSW 8 83210456 missense probably damaging 1.00
R0737:Tbc1d9 UTSW 8 83259313 missense probably damaging 1.00
R1144:Tbc1d9 UTSW 8 83236571 missense possibly damaging 0.93
R1354:Tbc1d9 UTSW 8 83268981 critical splice acceptor site probably null
R1551:Tbc1d9 UTSW 8 83266158 missense probably benign 0.03
R1620:Tbc1d9 UTSW 8 83249595 missense probably damaging 1.00
R1990:Tbc1d9 UTSW 8 83271303 missense probably damaging 1.00
R2082:Tbc1d9 UTSW 8 83270987 missense probably damaging 1.00
R2149:Tbc1d9 UTSW 8 83271449 missense probably damaging 1.00
R2442:Tbc1d9 UTSW 8 83166076 start codon destroyed probably null 0.08
R2920:Tbc1d9 UTSW 8 83210469 missense probably benign 0.00
R3832:Tbc1d9 UTSW 8 83233663 missense probably damaging 1.00
R3953:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3955:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3956:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3957:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R4117:Tbc1d9 UTSW 8 83266147 missense possibly damaging 0.93
R4467:Tbc1d9 UTSW 8 83210478 missense probably damaging 1.00
R4533:Tbc1d9 UTSW 8 83270918 missense probably damaging 1.00
R4568:Tbc1d9 UTSW 8 83271177 missense probably benign 0.00
R4694:Tbc1d9 UTSW 8 83234246 missense probably damaging 1.00
R4804:Tbc1d9 UTSW 8 83255925 critical splice donor site probably null
R5056:Tbc1d9 UTSW 8 83269206 missense probably benign
R5073:Tbc1d9 UTSW 8 83233547 missense probably damaging 1.00
R5122:Tbc1d9 UTSW 8 83236543 missense probably damaging 0.98
R5270:Tbc1d9 UTSW 8 83233654 missense probably benign
R5618:Tbc1d9 UTSW 8 83242592 missense probably damaging 1.00
R5738:Tbc1d9 UTSW 8 83271026 missense probably benign
R5793:Tbc1d9 UTSW 8 83271440 missense probably damaging 0.96
R5908:Tbc1d9 UTSW 8 83249545 missense probably benign 0.05
R6258:Tbc1d9 UTSW 8 83210516 missense probably damaging 1.00
R6584:Tbc1d9 UTSW 8 83261000 missense probably damaging 0.98
R6888:Tbc1d9 UTSW 8 83271588 missense possibly damaging 0.92
R6897:Tbc1d9 UTSW 8 83166180 missense probably damaging 1.00
R6969:Tbc1d9 UTSW 8 83241542 missense probably damaging 0.99
R7026:Tbc1d9 UTSW 8 83241563 missense probably benign 0.06
R7072:Tbc1d9 UTSW 8 83264865 missense probably damaging 0.97
R7099:Tbc1d9 UTSW 8 83254891 missense probably damaging 1.00
R7138:Tbc1d9 UTSW 8 83210484 missense probably damaging 1.00
R7172:Tbc1d9 UTSW 8 83254761 missense probably damaging 0.96
R7267:Tbc1d9 UTSW 8 83271328 missense probably damaging 1.00
R7371:Tbc1d9 UTSW 8 83271261 missense probably damaging 0.96
R7457:Tbc1d9 UTSW 8 83236680 missense probably damaging 0.99
R7552:Tbc1d9 UTSW 8 83239931 missense probably damaging 1.00
R7645:Tbc1d9 UTSW 8 83242553 missense probably damaging 1.00
R7728:Tbc1d9 UTSW 8 83259350 missense probably damaging 0.99
R7804:Tbc1d9 UTSW 8 83236712 missense possibly damaging 0.85
R7978:Tbc1d9 UTSW 8 83239954 missense probably damaging 0.98
R8150:Tbc1d9 UTSW 8 83255890 missense probably damaging 1.00
R8325:Tbc1d9 UTSW 8 83240038 critical splice donor site probably null
X0062:Tbc1d9 UTSW 8 83233702 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CATTGCTGTCTATAGCTGGATCAG -3'
(R):5'- GGTCTGATGCTGAATCTCGTC -3'

Sequencing Primer
(F):5'- CTGGATCAGCAGGATTTTAGCTTTC -3'
(R):5'- GATGCTGAATCTCGTCTGAATTC -3'
Posted On2014-08-25