Incidental Mutation 'R1354:Tbc1d9'
ID156244
Institutional Source Beutler Lab
Gene Symbol Tbc1d9
Ensembl Gene ENSMUSG00000031709
Gene NameTBC1 domain family, member 9
Synonyms4933431N12Rik, C76116
MMRRC Submission 039419-MU
Accession Numbers

Genbank: NM_001111304.1, NM_027758.4

Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R1354 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location83165352-83272934 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to C at 83268981 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034145] [ENSMUST00000093393]
Predicted Effect probably null
Transcript: ENSMUST00000034145
SMART Domains Protein: ENSMUSP00000034145
Gene: ENSMUSG00000031709

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
low complexity region 192 208 N/A INTRINSIC
TBC 279 492 8.68e-56 SMART
Blast:TBC 500 587 5e-35 BLAST
PDB:1BJF|B 579 703 3e-7 PDB
low complexity region 917 937 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093393
SMART Domains Protein: ENSMUSP00000091093
Gene: ENSMUSG00000031709

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
GRAM 146 213 1.2e-25 SMART
low complexity region 267 278 N/A INTRINSIC
GRAM 293 361 1.37e-20 SMART
low complexity region 425 441 N/A INTRINSIC
TBC 512 725 8.68e-56 SMART
Blast:TBC 733 820 6e-35 BLAST
PDB:1BJF|B 812 936 4e-7 PDB
low complexity region 1150 1170 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211568
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atoh1 A G 6: 64,729,357 E12G possibly damaging Het
Ccdc183 T C 2: 25,612,139 N241S probably benign Het
Cmya5 G A 13: 93,092,058 T2174I possibly damaging Het
Edem1 A G 6: 108,854,316 I579M possibly damaging Het
Gimap9 A T 6: 48,678,048 M190L probably benign Het
Glod4 A T 11: 76,237,828 probably null Het
Ighv8-6 A T 12: 115,166,080 S19T probably damaging Het
Lef1 C T 3: 131,194,668 P267S probably damaging Het
Megf11 A G 9: 64,653,177 E335G probably benign Het
Muc5ac A G 7: 141,807,377 N1475S probably damaging Het
Ndst2 C A 14: 20,724,975 R749L possibly damaging Het
Oas3 C A 5: 120,770,000 V292L possibly damaging Het
Phactr1 A T 13: 43,057,331 I210F possibly damaging Het
Plppr5 G A 3: 117,575,847 R51H possibly damaging Het
Ppp1r12b G A 1: 134,835,983 T771M probably benign Het
Rasgrf2 G A 13: 92,028,666 P331S probably damaging Het
Rtl6 C T 15: 84,556,527 V223M probably damaging Het
Tgm3 T C 2: 130,041,898 I492T probably benign Het
Trdv1 T A 14: 53,881,918 probably benign Het
Wdr45b A T 11: 121,335,430 I191N probably damaging Het
Other mutations in Tbc1d9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tbc1d9 APN 8 83234162 missense probably damaging 1.00
IGL01443:Tbc1d9 APN 8 83239931 missense probably damaging 1.00
IGL01536:Tbc1d9 APN 8 83260992 missense probably damaging 1.00
IGL01811:Tbc1d9 APN 8 83233678 missense probably damaging 1.00
IGL02068:Tbc1d9 APN 8 83239868 missense probably damaging 1.00
IGL02938:Tbc1d9 APN 8 83269067 splice site probably benign
IGL02995:Tbc1d9 APN 8 83269059 critical splice donor site probably null
IGL03127:Tbc1d9 APN 8 83249473 missense probably damaging 1.00
IGL03128:Tbc1d9 APN 8 83166085 missense probably benign 0.01
H9600:Tbc1d9 UTSW 8 83210461 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0112:Tbc1d9 UTSW 8 83264837 splice site probably benign
R0525:Tbc1d9 UTSW 8 83268985 missense probably benign 0.08
R0528:Tbc1d9 UTSW 8 83210456 missense probably damaging 1.00
R0737:Tbc1d9 UTSW 8 83259313 missense probably damaging 1.00
R1144:Tbc1d9 UTSW 8 83236571 missense possibly damaging 0.93
R1551:Tbc1d9 UTSW 8 83266158 missense probably benign 0.03
R1620:Tbc1d9 UTSW 8 83249595 missense probably damaging 1.00
R1971:Tbc1d9 UTSW 8 83249510 missense probably damaging 1.00
R1990:Tbc1d9 UTSW 8 83271303 missense probably damaging 1.00
R2082:Tbc1d9 UTSW 8 83270987 missense probably damaging 1.00
R2149:Tbc1d9 UTSW 8 83271449 missense probably damaging 1.00
R2442:Tbc1d9 UTSW 8 83166076 start codon destroyed probably null 0.08
R2920:Tbc1d9 UTSW 8 83210469 missense probably benign 0.00
R3832:Tbc1d9 UTSW 8 83233663 missense probably damaging 1.00
R3953:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3955:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3956:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3957:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R4117:Tbc1d9 UTSW 8 83266147 missense possibly damaging 0.93
R4467:Tbc1d9 UTSW 8 83210478 missense probably damaging 1.00
R4533:Tbc1d9 UTSW 8 83270918 missense probably damaging 1.00
R4568:Tbc1d9 UTSW 8 83271177 missense probably benign 0.00
R4694:Tbc1d9 UTSW 8 83234246 missense probably damaging 1.00
R4804:Tbc1d9 UTSW 8 83255925 critical splice donor site probably null
R5056:Tbc1d9 UTSW 8 83269206 missense probably benign
R5073:Tbc1d9 UTSW 8 83233547 missense probably damaging 1.00
R5122:Tbc1d9 UTSW 8 83236543 missense probably damaging 0.98
R5270:Tbc1d9 UTSW 8 83233654 missense probably benign
R5618:Tbc1d9 UTSW 8 83242592 missense probably damaging 1.00
R5738:Tbc1d9 UTSW 8 83271026 missense probably benign
R5793:Tbc1d9 UTSW 8 83271440 missense probably damaging 0.96
R5908:Tbc1d9 UTSW 8 83249545 missense probably benign 0.05
R6258:Tbc1d9 UTSW 8 83210516 missense probably damaging 1.00
R6584:Tbc1d9 UTSW 8 83261000 missense probably damaging 0.98
R6888:Tbc1d9 UTSW 8 83271588 missense possibly damaging 0.92
R6897:Tbc1d9 UTSW 8 83166180 missense probably damaging 1.00
R6969:Tbc1d9 UTSW 8 83241542 missense probably damaging 0.99
R7026:Tbc1d9 UTSW 8 83241563 missense probably benign 0.06
R7072:Tbc1d9 UTSW 8 83264865 missense probably damaging 0.97
R7099:Tbc1d9 UTSW 8 83254891 missense probably damaging 1.00
R7138:Tbc1d9 UTSW 8 83210484 missense probably damaging 1.00
R7172:Tbc1d9 UTSW 8 83254761 missense probably damaging 0.96
R7267:Tbc1d9 UTSW 8 83271328 missense probably damaging 1.00
R7371:Tbc1d9 UTSW 8 83271261 missense probably damaging 0.96
R7457:Tbc1d9 UTSW 8 83236680 missense probably damaging 0.99
R7552:Tbc1d9 UTSW 8 83239931 missense probably damaging 1.00
R7645:Tbc1d9 UTSW 8 83242553 missense probably damaging 1.00
R7728:Tbc1d9 UTSW 8 83259350 missense probably damaging 0.99
R7804:Tbc1d9 UTSW 8 83236712 missense possibly damaging 0.85
R7978:Tbc1d9 UTSW 8 83239954 missense probably damaging 0.98
R8150:Tbc1d9 UTSW 8 83255890 missense probably damaging 1.00
R8325:Tbc1d9 UTSW 8 83240038 critical splice donor site probably null
X0062:Tbc1d9 UTSW 8 83233702 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGAAATAAATCTGGGGCCATCCTTCAC -3'
(R):5'- TGCCCTTTTCCCTAAAACCCAAAAGT -3'

Sequencing Primer
(F):5'- tgctattagaaatgcactttgacc -3'
(R):5'- CCAAAAGTCAAGAGATGAGCATTC -3'
Posted On2014-02-11