Incidental Mutation 'R0189:Phf20'
ID23091
Institutional Source Beutler Lab
Gene Symbol Phf20
Ensembl Gene ENSMUSG00000038116
Gene NamePHD finger protein 20
Synonyms
MMRRC Submission 038450-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R0189 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location156196466-156309952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156303141 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 890 (S890G)
Ref Sequence ENSEMBL: ENSMUSP00000043138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037401]
Predicted Effect probably benign
Transcript: ENSMUST00000037401
AA Change: S890G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000043138
Gene: ENSMUSG00000038116
AA Change: S890G

DomainStartEndE-ValueType
TUDOR 11 71 5.27e0 SMART
TUDOR 85 141 7.13e-4 SMART
AT_hook 257 269 1.65e0 SMART
low complexity region 323 332 N/A INTRINSIC
ZnF_C2H2 455 480 1.86e0 SMART
low complexity region 486 493 N/A INTRINSIC
low complexity region 526 555 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
PHD 657 701 2.83e-4 SMART
coiled coil region 945 966 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152617
Meta Mutation Damage Score 0.0707 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 98% (96/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased body size and total body fat amount, and abnormal skeletal and hematopoietic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,096,947 V207A possibly damaging Het
Abca9 A T 11: 110,108,653 W1459R probably damaging Het
Abca9 A T 11: 110,141,662 probably benign Het
Adam25 T A 8: 40,755,430 C578S probably damaging Het
Adam32 T A 8: 24,922,337 probably null Het
Add1 T C 5: 34,616,648 V67A probably benign Het
Aggf1 A T 13: 95,356,480 probably benign Het
Ahcyl2 A T 6: 29,891,243 I449F probably benign Het
Ak6 A G 13: 100,655,142 Y31C probably damaging Het
Akap6 T C 12: 53,141,254 V1817A probably benign Het
Arhgef17 G T 7: 100,928,850 P964T probably damaging Het
Atxn7l3b A T 10: 112,928,580 L48Q possibly damaging Het
Bbs10 T G 10: 111,301,065 S680A probably damaging Het
Bcl7c G A 7: 127,705,764 T164I probably damaging Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Ccdc110 T A 8: 45,935,082 D25E probably damaging Het
Ccdc83 T A 7: 90,226,683 T327S possibly damaging Het
Coro1b T C 19: 4,153,251 Y364H probably damaging Het
Cstf3 A G 2: 104,652,446 D313G probably damaging Het
Dlgap5 T A 14: 47,412,975 probably null Het
Dusp3 A T 11: 101,981,721 I83N probably damaging Het
Eea1 A T 10: 95,995,582 K178N possibly damaging Het
Efr3b T A 12: 3,982,925 D144V probably damaging Het
Gm1110 T A 9: 26,883,218 E504V probably null Het
Got2 T C 8: 95,888,253 H18R probably benign Het
Gprc5b T C 7: 118,983,633 M338V probably benign Het
Has2 A T 15: 56,668,435 F295I probably damaging Het
Hcn3 T C 3: 89,148,800 D519G probably damaging Het
Ino80 T A 2: 119,379,679 D1377V probably benign Het
Iqsec3 A T 6: 121,413,562 probably benign Het
Kif3c T A 12: 3,365,989 S3R probably benign Het
Krt17 A G 11: 100,260,619 I116T possibly damaging Het
Lrba T C 3: 86,368,509 V1728A probably damaging Het
Map3k6 G T 4: 133,246,941 V550L possibly damaging Het
Mcph1 T C 8: 18,788,471 V803A probably damaging Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Msh5 T C 17: 35,029,654 E772G probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndfip2 T C 14: 105,304,740 L308P probably damaging Het
Ndufb10 T C 17: 24,724,235 T34A probably benign Het
Nipal3 A T 4: 135,468,518 I258N possibly damaging Het
Nup54 A G 5: 92,422,564 V328A probably damaging Het
Olfr1410 T C 1: 92,607,893 F19L probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr615 G T 7: 103,561,082 V202F probably benign Het
Olfr763 T A 10: 129,011,322 F12L possibly damaging Het
Olfr923 T A 9: 38,827,815 Y41* probably null Het
Oprm1 T C 10: 6,789,071 V66A possibly damaging Het
Peg12 G A 7: 62,463,548 T267I unknown Het
Plk2 C T 13: 110,399,463 T567M probably damaging Het
Pola2 A T 19: 5,942,342 probably benign Het
Ppp1r12b A G 1: 134,865,776 probably null Het
Prickle1 A T 15: 93,503,019 L528* probably null Het
Prpf6 T A 2: 181,655,457 N903K probably benign Het
Ptprc G A 1: 138,082,715 A601V probably benign Het
Ranbp1 A T 16: 18,241,743 probably null Het
Rapgef6 C T 11: 54,691,249 S1334L probably benign Het
Rgs2 T C 1: 144,002,284 probably null Het
Ripk2 A T 4: 16,129,125 probably null Het
Rnf17 A G 14: 56,482,193 S967G probably null Het
Rock2 T A 12: 16,959,516 probably benign Het
Rpusd3 C T 6: 113,415,553 probably null Het
Scgb1b20 G T 7: 33,373,510 V48L probably benign Het
Sec16a T A 2: 26,424,414 probably null Het
Serpina5 T A 12: 104,103,330 L267H probably damaging Het
Slc12a3 C T 8: 94,356,358 H875Y probably benign Het
Slc45a4 A G 15: 73,581,914 S745P probably benign Het
Sucla2 T C 14: 73,592,648 V375A probably damaging Het
Sun2 C A 15: 79,737,076 V213F probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 C T 6: 7,562,424 R129C probably damaging Het
Taf6 T C 5: 138,182,713 E202G probably benign Het
Tex21 T A 12: 76,239,533 H64L probably benign Het
Tgs1 A G 4: 3,593,620 S503G probably benign Het
Tmem184c C T 8: 77,597,812 V350I possibly damaging Het
Tnks1bp1 A G 2: 85,070,929 S960G possibly damaging Het
Trbc2 T C 6: 41,548,149 probably benign Het
Tsta3 C A 15: 75,926,978 D127Y probably damaging Het
Tubgcp2 A T 7: 140,001,605 probably benign Het
Vmn1r39 T A 6: 66,805,197 T46S probably benign Het
Vmn1r61 T C 7: 5,610,700 H205R probably benign Het
Zdhhc14 T C 17: 5,725,264 S264P possibly damaging Het
Zfp101 T A 17: 33,382,239 H181L possibly damaging Het
Other mutations in Phf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Phf20 APN 2 156304816 critical splice donor site probably null
IGL01071:Phf20 APN 2 156294088 splice site probably null
IGL01125:Phf20 APN 2 156303184 splice site probably null
IGL01608:Phf20 APN 2 156276596 missense probably benign
IGL01610:Phf20 APN 2 156302889 nonsense probably null
IGL01845:Phf20 APN 2 156276657 nonsense probably null
IGL02364:Phf20 APN 2 156294097 missense possibly damaging 0.80
IGL02692:Phf20 APN 2 156298578 missense probably damaging 1.00
IGL03039:Phf20 APN 2 156298541 missense probably damaging 1.00
R0016:Phf20 UTSW 2 156267194 nonsense probably null
R1532:Phf20 UTSW 2 156303049 missense possibly damaging 0.89
R1572:Phf20 UTSW 2 156287834 missense probably benign 0.17
R2007:Phf20 UTSW 2 156287954 missense probably benign 0.00
R2191:Phf20 UTSW 2 156276654 missense probably benign
R3011:Phf20 UTSW 2 156288026 missense probably benign 0.32
R3024:Phf20 UTSW 2 156287867 missense probably damaging 0.96
R4242:Phf20 UTSW 2 156307454 unclassified probably benign
R5053:Phf20 UTSW 2 156273862 missense probably benign 0.00
R5089:Phf20 UTSW 2 156302862 missense probably benign
R5382:Phf20 UTSW 2 156267497 missense probably damaging 1.00
R5649:Phf20 UTSW 2 156251768 splice site probably null
R5707:Phf20 UTSW 2 156296771 intron probably null
R5751:Phf20 UTSW 2 156267341 missense probably benign 0.01
R5805:Phf20 UTSW 2 156307294 missense probably damaging 0.99
R5988:Phf20 UTSW 2 156307330 missense probably damaging 1.00
R6179:Phf20 UTSW 2 156298653 missense probably damaging 1.00
R6243:Phf20 UTSW 2 156223400 missense probably benign 0.16
R6338:Phf20 UTSW 2 156273686 missense possibly damaging 0.93
R6351:Phf20 UTSW 2 156294210 missense possibly damaging 0.91
R6584:Phf20 UTSW 2 156294123 missense probably damaging 0.99
R7248:Phf20 UTSW 2 156293411 splice site probably null
R7329:Phf20 UTSW 2 156304632 missense probably damaging 0.96
R7387:Phf20 UTSW 2 156294240 missense probably damaging 1.00
R7528:Phf20 UTSW 2 156303008 nonsense probably null
R7603:Phf20 UTSW 2 156302851 missense probably benign
R7698:Phf20 UTSW 2 156294138 missense probably damaging 1.00
RF011:Phf20 UTSW 2 156304620 critical splice acceptor site probably benign
RF011:Phf20 UTSW 2 156304621 critical splice acceptor site probably benign
RF028:Phf20 UTSW 2 156304623 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTGAGCATTGCTACCAGAAACC -3'
(R):5'- AGGCACAGTGGCACTCATGAAG -3'

Sequencing Primer
(F):5'- GAAACCTCGCGCCTATTATCC -3'
(R):5'- AGGAGGTCCCTTAACTTTGTACAC -3'
Posted On2013-04-16