Incidental Mutation 'R2088:Galnt4'
ID231598
Institutional Source Beutler Lab
Gene Symbol Galnt4
Ensembl Gene ENSMUSG00000090035
Gene Namepolypeptide N-acetylgalactosaminyltransferase 4
SynonymsppGaNTase-T4
MMRRC Submission 040093-MU
Accession Numbers

Genbank: NM_015737; MGI: 894692

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2088 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location99108159-99113247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99109184 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 257 (D257G)
Ref Sequence ENSEMBL: ENSMUSP00000125315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020113] [ENSMUST00000159228] [ENSMUST00000159990] [ENSMUST00000161240] [ENSMUST00000219884]
Predicted Effect probably benign
Transcript: ENSMUST00000020113
SMART Domains Protein: ENSMUSP00000020113
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 428 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159228
SMART Domains Protein: ENSMUSP00000124144
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 401 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159990
SMART Domains Protein: ENSMUSP00000125423
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 8.68e-9 SMART
WD40 49 88 2.71e-10 SMART
WD40 91 130 2.43e-12 SMART
WD40 133 172 2.07e-6 SMART
WD40 175 214 1.71e-7 SMART
WD40 217 256 7.55e-9 SMART
coiled coil region 386 426 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161240
AA Change: D257G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125315
Gene: ENSMUSG00000090035
AA Change: D257G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 135 382 4.7e-10 PFAM
Pfam:Glycos_transf_2 138 321 7.5e-38 PFAM
Pfam:Glyco_tranf_2_2 138 368 1e-7 PFAM
Pfam:Glyco_transf_7C 298 367 4.5e-10 PFAM
low complexity region 411 420 N/A INTRINSIC
RICIN 445 577 2.39e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218379
Predicted Effect probably benign
Transcript: ENSMUST00000219884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220019
Meta Mutation Damage Score 0.7739 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. In vitro, the encoded protein can complement other GalNAc-Ts in the complete O-glycosylation of the mucin-1 tandem repeat and can O-glycosylate the P-selectin glycoprotein ligand-1 molecule. The coding region of this gene is contained within a single exon. Fusion transcripts, which combine part of this gene with the 5' exons of the neighboring POC1B (POC1 centriolar protein homolog B) gene, also exist. [provided by RefSeq, Dec 2010]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik T C 9: 58,499,005 F66S probably damaging Het
Ankk1 T C 9: 49,421,965 probably benign Het
Ano5 T A 7: 51,587,706 N759K possibly damaging Het
Arhgef10 A G 8: 14,983,898 T1072A possibly damaging Het
BC107364 T C 3: 96,434,429 T93A unknown Het
Canx C T 11: 50,310,390 E97K possibly damaging Het
Casp8ap2 T C 4: 32,631,126 L62P probably damaging Het
Cbfa2t3 C T 8: 122,637,986 probably benign Het
Cmya5 A T 13: 93,092,812 S1923T probably damaging Het
Cntnap1 T A 11: 101,182,547 I618N probably damaging Het
Cox17 C G 16: 38,347,180 P27R probably damaging Het
Ctnna3 A G 10: 64,873,207 E675G probably damaging Het
Cul9 A G 17: 46,526,649 L990P probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Eif2d T C 1: 131,164,727 V374A probably damaging Het
Fhdc1 T C 3: 84,474,726 probably benign Het
Fryl T A 5: 73,065,461 I1926F probably benign Het
Gatm A G 2: 122,598,148 V344A probably benign Het
Gli1 T G 10: 127,331,500 Y628S probably damaging Het
Gpr1 A T 1: 63,183,652 probably null Het
Gsdmc3 A C 15: 63,860,214 probably null Het
Hap1 T C 11: 100,356,002 T26A probably benign Het
Helz2 C T 2: 181,235,102 G1200S probably benign Het
Iqgap2 C T 13: 95,891,663 probably null Het
Itga3 T A 11: 95,052,494 I895F probably benign Het
Klhl33 A T 14: 50,892,773 C421* probably null Het
Klra2 T C 6: 131,242,826 T131A probably damaging Het
Krt14 T C 11: 100,204,123 E426G possibly damaging Het
Limd2 A G 11: 106,158,742 F107L probably damaging Het
Lipo4 A T 19: 33,500,069 N318K possibly damaging Het
Mab21l2 T G 3: 86,547,009 D228A probably damaging Het
Moxd2 G A 6: 40,884,967 H224Y probably damaging Het
Mpp4 T C 1: 59,123,465 Y521C possibly damaging Het
Msto1 C T 3: 88,910,990 A317T probably damaging Het
Mtmr4 T C 11: 87,610,967 S559P probably damaging Het
Muc4 T A 16: 32,756,409 H2094Q unknown Het
Ndufa11 C A 17: 56,717,922 T28K probably damaging Het
Olfr124 A G 17: 37,805,795 T217A probably benign Het
Olfr1289 G T 2: 111,484,278 A283S probably damaging Het
Orai2 C A 5: 136,150,756 R155L probably damaging Het
Pde4c A G 8: 70,749,356 D582G possibly damaging Het
Pde4dip T C 3: 97,754,433 E609G probably null Het
Prune2 A G 19: 17,119,745 D871G possibly damaging Het
Rbpms2 T A 9: 65,630,839 L4Q probably damaging Het
Rhbg T C 3: 88,247,458 Y213C probably damaging Het
Rplp0 T A 5: 115,562,503 N243K possibly damaging Het
Rtp4 A T 16: 23,613,213 H165L possibly damaging Het
Ryr2 C A 13: 11,662,229 M3245I probably benign Het
Sh2b2 T A 5: 136,232,114 M83L possibly damaging Het
Simc1 T C 13: 54,541,534 I284T probably damaging Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc46a1 T C 11: 78,468,645 S368P possibly damaging Het
St6galnac1 A G 11: 116,769,107 S127P probably benign Het
Tatdn3 A G 1: 191,052,876 I192T possibly damaging Het
Tmem25 C A 9: 44,796,086 V239F possibly damaging Het
Tprkb A C 6: 85,932,940 probably benign Het
Trappc10 A G 10: 78,196,334 V1040A probably benign Het
Txnrd1 G A 10: 82,883,910 probably benign Het
Uhrf1 A T 17: 56,318,089 K544M probably damaging Het
Unc80 T A 1: 66,590,227 H1294Q possibly damaging Het
Uspl1 T A 5: 149,209,750 I437K probably damaging Het
Vmn1r232 A T 17: 20,913,737 N200K possibly damaging Het
Vmn2r19 A T 6: 123,335,836 I622F probably damaging Het
Znfx1 A G 2: 167,055,810 F398S probably damaging Het
Other mutations in Galnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Galnt4 APN 10 99109597 missense probably damaging 1.00
IGL01725:Galnt4 APN 10 99109957 missense probably damaging 1.00
IGL01871:Galnt4 APN 10 99109241 missense probably damaging 1.00
IGL02146:Galnt4 APN 10 99109701 missense possibly damaging 0.87
3-1:Galnt4 UTSW 10 99109265 missense probably damaging 1.00
R0041:Galnt4 UTSW 10 99108512 missense probably benign 0.08
R1318:Galnt4 UTSW 10 99109910 missense probably damaging 0.99
R1466:Galnt4 UTSW 10 99108709 missense probably benign 0.43
R1466:Galnt4 UTSW 10 99108709 missense probably benign 0.43
R1471:Galnt4 UTSW 10 99108674 missense probably benign
R1633:Galnt4 UTSW 10 99109952 missense possibly damaging 0.88
R2197:Galnt4 UTSW 10 99108647 missense probably damaging 1.00
R2363:Galnt4 UTSW 10 99109061 missense probably damaging 1.00
R2507:Galnt4 UTSW 10 99109286 missense possibly damaging 0.78
R3104:Galnt4 UTSW 10 99109381 missense probably benign 0.10
R3106:Galnt4 UTSW 10 99109381 missense probably benign 0.10
R4599:Galnt4 UTSW 10 99109493 missense probably damaging 1.00
R4670:Galnt4 UTSW 10 99109298 missense possibly damaging 0.60
R4756:Galnt4 UTSW 10 99108500 missense probably benign
R5660:Galnt4 UTSW 10 99109535 missense probably benign 0.16
R5819:Galnt4 UTSW 10 99110030 missense probably damaging 1.00
R6441:Galnt4 UTSW 10 99110098 missense possibly damaging 0.95
R7184:Galnt4 UTSW 10 99108604 missense probably damaging 1.00
R7429:Galnt4 UTSW 10 99109748 missense probably damaging 1.00
R7685:Galnt4 UTSW 10 99109964 missense probably benign 0.00
R7788:Galnt4 UTSW 10 99109113 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGGCGCAACTTGAAACTTAC -3'
(R):5'- GCTGACAGCAAACAGTCCTC -3'

Sequencing Primer
(F):5'- TTACATCAGCAACCTGGAGAGAGTTC -3'
(R):5'- AAACAGTCCTCCTGCCATGGTG -3'
Posted On2014-09-18