Incidental Mutation 'R6441:Galnt4'
ID519026
Institutional Source Beutler Lab
Gene Symbol Galnt4
Ensembl Gene ENSMUSG00000090035
Gene Namepolypeptide N-acetylgalactosaminyltransferase 4
SynonymsppGaNTase-T4
MMRRC Submission
Accession Numbers

Genbank: NM_015737; MGI: 894692

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6441 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location99108159-99113247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99110098 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 562 (M562V)
Ref Sequence ENSEMBL: ENSMUSP00000125315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020113] [ENSMUST00000159228] [ENSMUST00000159990] [ENSMUST00000161240] [ENSMUST00000219884]
Predicted Effect probably benign
Transcript: ENSMUST00000020113
SMART Domains Protein: ENSMUSP00000020113
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 428 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159228
SMART Domains Protein: ENSMUSP00000124144
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 401 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159990
SMART Domains Protein: ENSMUSP00000125423
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 8.68e-9 SMART
WD40 49 88 2.71e-10 SMART
WD40 91 130 2.43e-12 SMART
WD40 133 172 2.07e-6 SMART
WD40 175 214 1.71e-7 SMART
WD40 217 256 7.55e-9 SMART
coiled coil region 386 426 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161240
AA Change: M562V

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125315
Gene: ENSMUSG00000090035
AA Change: M562V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 135 382 4.7e-10 PFAM
Pfam:Glycos_transf_2 138 321 7.5e-38 PFAM
Pfam:Glyco_tranf_2_2 138 368 1e-7 PFAM
Pfam:Glyco_transf_7C 298 367 4.5e-10 PFAM
low complexity region 411 420 N/A INTRINSIC
RICIN 445 577 2.39e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218379
Predicted Effect probably benign
Transcript: ENSMUST00000219884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220019
Meta Mutation Damage Score 0.1749 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. In vitro, the encoded protein can complement other GalNAc-Ts in the complete O-glycosylation of the mucin-1 tandem repeat and can O-glycosylate the P-selectin glycoprotein ligand-1 molecule. The coding region of this gene is contained within a single exon. Fusion transcripts, which combine part of this gene with the 5' exons of the neighboring POC1B (POC1 centriolar protein homolog B) gene, also exist. [provided by RefSeq, Dec 2010]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,771,459 M1047K probably benign Het
Apob A T 12: 7,987,796 D322V probably damaging Het
Capn12 T A 7: 28,888,002 C438S probably benign Het
Cdh23 A T 10: 60,308,036 V2932E probably damaging Het
Cdh9 A T 15: 16,823,423 T164S probably benign Het
CN725425 T C 15: 91,235,802 V42A probably benign Het
Cpb1 T C 3: 20,249,814 D362G probably damaging Het
Csmd2 C A 4: 128,394,964 Q1099K probably benign Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Gtf3c3 T A 1: 54,406,038 E619V probably benign Het
Gucy2c A T 6: 136,723,761 M585K probably damaging Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Lonrf2 T C 1: 38,818,123 E44G possibly damaging Het
Lrit3 A T 3: 129,800,360 F189L probably benign Het
Mag T C 7: 30,907,083 N310D possibly damaging Het
Mccc2 T C 13: 99,954,676 T151A probably damaging Het
Mybpc1 A T 10: 88,553,277 S49T probably benign Het
Myh2 A G 11: 67,194,611 E1787G probably benign Het
Ncapd3 A G 9: 27,063,416 D728G probably benign Het
Nup37 A G 10: 88,160,937 E139G probably benign Het
Odf3 T C 7: 140,849,248 S149P probably damaging Het
Olfr651 C T 7: 104,553,335 Q139* probably null Het
Pcdhgb5 A G 18: 37,732,085 Y311C probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Rbm44 A T 1: 91,157,077 N674Y probably damaging Het
Ryr1 T C 7: 29,059,695 I3353V possibly damaging Het
Sema3c C T 5: 17,724,132 T588I possibly damaging Het
Sh2d5 A T 4: 138,259,082 E372V possibly damaging Het
Slc27a6 C T 18: 58,572,058 P171S probably benign Het
Slfn3 C T 11: 83,214,914 T579I probably benign Het
Svil T G 18: 5,049,323 V287G probably benign Het
Tas1r2 T A 4: 139,669,156 V602D probably damaging Het
Tln2 A G 9: 67,272,689 L800P probably damaging Het
Trim31 C A 17: 36,907,791 Q323K possibly damaging Het
Txndc9 T A 1: 37,990,218 D183V possibly damaging Het
Vmn2r28 T A 7: 5,488,475 M258L probably benign Het
Vmn2r75 A T 7: 86,171,576 I50N probably damaging Het
Zgrf1 A T 3: 127,588,034 N1161Y possibly damaging Het
Other mutations in Galnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Galnt4 APN 10 99109597 missense probably damaging 1.00
IGL01725:Galnt4 APN 10 99109957 missense probably damaging 1.00
IGL01871:Galnt4 APN 10 99109241 missense probably damaging 1.00
IGL02146:Galnt4 APN 10 99109701 missense possibly damaging 0.87
3-1:Galnt4 UTSW 10 99109265 missense probably damaging 1.00
R0041:Galnt4 UTSW 10 99108512 missense probably benign 0.08
R1318:Galnt4 UTSW 10 99109910 missense probably damaging 0.99
R1466:Galnt4 UTSW 10 99108709 missense probably benign 0.43
R1466:Galnt4 UTSW 10 99108709 missense probably benign 0.43
R1471:Galnt4 UTSW 10 99108674 missense probably benign
R1633:Galnt4 UTSW 10 99109952 missense possibly damaging 0.88
R2088:Galnt4 UTSW 10 99109184 missense probably damaging 1.00
R2197:Galnt4 UTSW 10 99108647 missense probably damaging 1.00
R2363:Galnt4 UTSW 10 99109061 missense probably damaging 1.00
R2507:Galnt4 UTSW 10 99109286 missense possibly damaging 0.78
R3104:Galnt4 UTSW 10 99109381 missense probably benign 0.10
R3106:Galnt4 UTSW 10 99109381 missense probably benign 0.10
R4599:Galnt4 UTSW 10 99109493 missense probably damaging 1.00
R4670:Galnt4 UTSW 10 99109298 missense possibly damaging 0.60
R4756:Galnt4 UTSW 10 99108500 missense probably benign
R5660:Galnt4 UTSW 10 99109535 missense probably benign 0.16
R5819:Galnt4 UTSW 10 99110030 missense probably damaging 1.00
R7184:Galnt4 UTSW 10 99108604 missense probably damaging 1.00
R7429:Galnt4 UTSW 10 99109748 missense probably damaging 1.00
R7685:Galnt4 UTSW 10 99109964 missense probably benign 0.00
R7788:Galnt4 UTSW 10 99109113 missense possibly damaging 0.93
R8192:Galnt4 UTSW 10 99109256 missense probably benign 0.29
R8896:Galnt4 UTSW 10 99110093 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAATTATGTGCAGAGGTCCCC -3'
(R):5'- CTGTGTACCCAGCTTCAGAG -3'

Sequencing Primer
(F):5'- GTCCCCCAACAAAAGGATTATGTAGG -3'
(R):5'- GCTTCAGAGTGATATCCCCAGATG -3'
Posted On2018-05-24