Incidental Mutation 'R2166:Gm973'
ID235475
Institutional Source Beutler Lab
Gene Symbol Gm973
Ensembl Gene ENSMUSG00000047361
Gene Namepredicted gene 973
SynonymsLOC381260
MMRRC Submission 040169-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R2166 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location59516264-59636417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59526739 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 39 (D39G)
Ref Sequence ENSEMBL: ENSMUSP00000109881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114243] [ENSMUST00000186434]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114243
AA Change: D39G

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109881
Gene: ENSMUSG00000047361
AA Change: D39G

DomainStartEndE-ValueType
low complexity region 364 375 N/A INTRINSIC
Pfam:DUF4670 583 1045 7.3e-160 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186434
AA Change: D38G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.1276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Birc6 A T 17: 74,635,795 T2761S probably benign Het
Cav1 A T 6: 17,339,431 I141F possibly damaging Het
Gpr1 A G 1: 63,183,948 F43L probably benign Het
Gucy1a2 T A 9: 3,579,513 probably null Het
Il1b A T 2: 129,365,048 M264K probably damaging Het
Itpr1 A G 6: 108,388,225 Y38C probably damaging Het
Kcnb2 A C 1: 15,711,316 D804A possibly damaging Het
Kcnt1 T A 2: 25,891,183 probably benign Het
Krt6b T C 15: 101,678,615 probably null Het
Mef2a A G 7: 67,266,122 V144A probably damaging Het
Mroh3 A G 1: 136,186,053 M666T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nalcn T A 14: 123,369,951 Y702F probably benign Het
Napepld T A 5: 21,683,232 K73I possibly damaging Het
Olfr191 T A 16: 59,085,586 K299I probably benign Het
Olfr935 G A 9: 38,995,217 Q73* probably null Het
Pappa A C 4: 65,156,445 D412A probably damaging Het
Plbd1 A G 6: 136,613,790 probably null Het
Ppp1r10 G T 17: 35,930,589 R752L unknown Het
Prep T C 10: 45,092,655 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptprz1 A G 6: 23,045,633 N2134S possibly damaging Het
Rhbdl3 A G 11: 80,319,697 Y92C probably damaging Het
Rtkn2 T C 10: 68,041,696 S532P possibly damaging Het
Rtl1 T A 12: 109,590,554 H1617L probably damaging Het
Skint6 T A 4: 112,854,452 N956I probably benign Het
Slc13a2 A G 11: 78,403,075 V287A probably benign Het
Slc9a2 A G 1: 40,742,768 K386E probably damaging Het
Spata20 G A 11: 94,479,104 H789Y probably benign Het
Stk19 A G 17: 34,832,510 I23T possibly damaging Het
Tonsl A G 15: 76,637,313 I293T probably benign Het
Topbp1 A G 9: 103,312,929 probably null Het
Trappc2l T A 8: 122,613,162 S44T probably benign Het
Tsr1 A G 11: 74,907,454 probably null Het
Ugdh A G 5: 65,417,014 probably benign Het
Unc119 A G 11: 78,347,335 probably null Het
Zkscan14 G A 5: 145,196,134 P196S probably benign Het
Zmat4 T C 8: 23,902,136 L36P probably damaging Het
Other mutations in Gm973
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Gm973 APN 1 59630279 missense probably benign 0.00
IGL01732:Gm973 APN 1 59630237 missense probably benign 0.24
IGL02124:Gm973 APN 1 59582473 nonsense probably null
IGL02251:Gm973 APN 1 59582423 missense probably benign 0.18
IGL02818:Gm973 APN 1 59541475 critical splice donor site probably null
IGL03385:Gm973 APN 1 59582470 missense probably benign 0.14
R0105:Gm973 UTSW 1 59582474 missense probably null 0.60
R0105:Gm973 UTSW 1 59582474 missense probably null 0.60
R0280:Gm973 UTSW 1 59544680 frame shift probably null
R0490:Gm973 UTSW 1 59558234 splice site probably benign
R0491:Gm973 UTSW 1 59558234 splice site probably benign
R0508:Gm973 UTSW 1 59582490 splice site probably benign
R0636:Gm973 UTSW 1 59551144 missense probably benign 0.13
R0709:Gm973 UTSW 1 59558234 splice site probably benign
R0900:Gm973 UTSW 1 59566668 missense probably benign 0.00
R1758:Gm973 UTSW 1 59634010 missense unknown
R1816:Gm973 UTSW 1 59582399 missense probably damaging 0.99
R1975:Gm973 UTSW 1 59562771 missense possibly damaging 0.50
R3052:Gm973 UTSW 1 59633140 splice site probably benign
R3899:Gm973 UTSW 1 59625140 missense probably benign 0.00
R4181:Gm973 UTSW 1 59551240 missense possibly damaging 0.93
R4302:Gm973 UTSW 1 59551240 missense possibly damaging 0.93
R4623:Gm973 UTSW 1 59556276 missense probably damaging 1.00
R4642:Gm973 UTSW 1 59558114 missense probably damaging 1.00
R4716:Gm973 UTSW 1 59552554 nonsense probably null
R4920:Gm973 UTSW 1 59627566 missense probably benign
R4951:Gm973 UTSW 1 59541474 critical splice donor site probably null
R5214:Gm973 UTSW 1 59526721 missense probably damaging 1.00
R5225:Gm973 UTSW 1 59562700 missense probably benign 0.01
R5472:Gm973 UTSW 1 59628287 splice site probably null
R5554:Gm973 UTSW 1 59526972 missense probably benign 0.09
R5709:Gm973 UTSW 1 59552555 missense possibly damaging 0.73
R5886:Gm973 UTSW 1 59558250 intron probably benign
R6044:Gm973 UTSW 1 59628234 missense probably benign
R6046:Gm973 UTSW 1 59632350 missense unknown
R6818:Gm973 UTSW 1 59630169 missense probably damaging 0.99
R6920:Gm973 UTSW 1 59552461 missense possibly damaging 0.76
R6999:Gm973 UTSW 1 59634092 missense unknown
R7214:Gm973 UTSW 1 59562729 nonsense probably null
R7418:Gm973 UTSW 1 59526813 missense probably damaging 1.00
R7780:Gm973 UTSW 1 59558130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACAGTGTTTGCTGCAGAAG -3'
(R):5'- AAGGTCCTGCTTCTTCCTGG -3'

Sequencing Primer
(F):5'- TCCTTTGCACAGGTAGAGC -3'
(R):5'- GGGACCTCTTTTCCTGTCTCTGG -3'
Posted On2014-10-01