Incidental Mutation 'R2182:Pcsk7'
ID237248
Institutional Source Beutler Lab
Gene Symbol Pcsk7
Ensembl Gene ENSMUSG00000035382
Gene Nameproprotein convertase subtilisin/kexin type 7
SynonymsSPC7
MMRRC Submission 040184-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2182 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45906497-45929726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45928619 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 702 (C702S)
Ref Sequence ENSEMBL: ENSMUSP00000150393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034590] [ENSMUST00000039059] [ENSMUST00000215189] [ENSMUST00000215509] [ENSMUST00000216672]
Predicted Effect probably benign
Transcript: ENSMUST00000034590
SMART Domains Protein: ENSMUSP00000034590
Gene: ENSMUSG00000032085

DomainStartEndE-ValueType
CH 26 133 1.53e-20 SMART
Pfam:Calponin 175 199 5.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039059
AA Change: C702S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047508
Gene: ENSMUSG00000035382
AA Change: C702S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:S8_pro-domain 52 140 9.7e-21 PFAM
Pfam:Peptidase_S8 177 464 4.7e-43 PFAM
Pfam:P_proprotein 524 611 1.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214425
Predicted Effect probably benign
Transcript: ENSMUST00000215189
Predicted Effect probably benign
Transcript: ENSMUST00000215509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216614
Predicted Effect probably benign
Transcript: ENSMUST00000216672
AA Change: C702S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. It encodes a type 1 membrane bound protease that is expressed in many tissues, including neuroendocrine, liver, gut, and brain. The encoded protein undergoes an initial autocatalytic processing event in the ER and then sorts to the trans-Golgi network through endosomes where a second autocatalytic event takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It can process proalbumin and is thought to be responsible for the activation of HIV envelope glycoproteins gp160 and gp140. This gene has been implicated in the transcriptional regulation of housekeeping genes and plays a role in the regulation of iron metabolism. A t(11;14)(q23;q32) chromosome translocation associated with B-cell lymphoma occurs between this gene and its inverted counterpart. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,422,943 H17R probably damaging Het
Abca15 G A 7: 120,340,227 W281* probably null Het
Aloxe3 G A 11: 69,129,600 V157M possibly damaging Het
Arhgap26 G T 18: 39,357,809 probably benign Het
Atp7b T C 8: 22,014,547 N698S probably damaging Het
Casc4 A G 2: 121,867,428 D75G probably damaging Het
Clec4a4 A G 6: 123,013,757 probably null Het
Clgn C T 8: 83,410,410 T252I possibly damaging Het
Cyp2a12 A T 7: 27,031,146 N179Y probably damaging Het
D630045J12Rik C T 6: 38,174,147 probably null Het
Dennd5a G T 7: 109,933,994 R190S probably benign Het
Dtx4 C A 19: 12,483,107 G384V probably null Het
Dxo T C 17: 34,838,892 V191A probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fntb A G 12: 76,862,535 N99S probably benign Het
Gm5773 T A 3: 93,773,513 I164K probably benign Het
Hyal5 T C 6: 24,877,880 I325T probably damaging Het
Igsf8 G A 1: 172,290,728 probably null Het
Lamc2 A G 1: 153,126,866 V17A possibly damaging Het
Lpxn T C 19: 12,832,758 probably null Het
Macf1 A G 4: 123,492,671 V1296A probably damaging Het
Mpdz A T 4: 81,348,722 L318Q probably damaging Het
Mpl T A 4: 118,457,413 Q13L probably benign Het
Mpnd A G 17: 56,015,964 S399G probably benign Het
Mrps5 T C 2: 127,602,487 L347P probably damaging Het
Naip1 T A 13: 100,413,680 Q1217H probably benign Het
Nav2 G A 7: 49,597,254 V2176I probably benign Het
Olfr1341 T C 4: 118,710,345 *313R probably null Het
Olfr853 T C 9: 19,537,342 N196S probably benign Het
Olfr902 A G 9: 38,449,124 N84S probably benign Het
Olfr957 A T 9: 39,511,426 M98K probably damaging Het
Pbx2 C A 17: 34,595,666 Y324* probably null Het
Pramef6 T A 4: 143,897,190 H138L possibly damaging Het
Rictor T C 15: 6,772,204 S458P probably damaging Het
Rnf219 A G 14: 104,506,176 S156P possibly damaging Het
Scaf4 T C 16: 90,230,140 M905V probably benign Het
Scarf2 T C 16: 17,803,022 C185R probably damaging Het
Scd1 T G 19: 44,403,293 I101L probably benign Het
Slc6a2 A G 8: 92,961,248 M1V probably null Het
Sost T C 11: 101,963,850 Y211C probably damaging Het
Sphkap A G 1: 83,276,684 S828P probably damaging Het
Tnn T C 1: 160,140,600 probably null Het
Tnrc18 T C 5: 142,760,061 K1319R unknown Het
Vmn2r60 A G 7: 42,195,507 T765A probably benign Het
Vmn2r91 C A 17: 18,105,429 T103K possibly damaging Het
Zbtb44 T C 9: 31,066,676 C429R possibly damaging Het
Zc3h4 G A 7: 16,422,516 G327D unknown Het
Zfp292 A G 4: 34,807,417 C1876R probably damaging Het
Zfp839 C T 12: 110,868,338 L676F probably damaging Het
Zg16 A G 7: 127,050,372 L139P probably damaging Het
Zscan12 A G 13: 21,368,791 I262V probably benign Het
Other mutations in Pcsk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Pcsk7 APN 9 45927660 missense probably benign
IGL01081:Pcsk7 APN 9 45928707 missense probably benign
IGL02634:Pcsk7 APN 9 45919262 missense possibly damaging 0.87
IGL02999:Pcsk7 APN 9 45927599 missense possibly damaging 0.68
IGL03115:Pcsk7 APN 9 45914372 missense probably damaging 1.00
IGL03149:Pcsk7 APN 9 45909480 missense probably benign 0.37
R0243:Pcsk7 UTSW 9 45916059 missense probably damaging 1.00
R0324:Pcsk7 UTSW 9 45913011 missense possibly damaging 0.87
R0947:Pcsk7 UTSW 9 45911172 missense probably damaging 1.00
R1443:Pcsk7 UTSW 9 45925986 missense probably damaging 1.00
R1545:Pcsk7 UTSW 9 45914348 missense probably damaging 1.00
R2939:Pcsk7 UTSW 9 45916024 missense probably damaging 1.00
R3739:Pcsk7 UTSW 9 45926759 missense possibly damaging 0.72
R4039:Pcsk7 UTSW 9 45928007 splice site probably null
R4348:Pcsk7 UTSW 9 45919348 missense probably damaging 1.00
R4974:Pcsk7 UTSW 9 45918862 missense probably damaging 1.00
R5817:Pcsk7 UTSW 9 45926033 missense probably benign 0.01
R6214:Pcsk7 UTSW 9 45910376 missense possibly damaging 0.47
R6215:Pcsk7 UTSW 9 45910376 missense possibly damaging 0.47
R6408:Pcsk7 UTSW 9 45909696 missense probably benign 0.18
R7338:Pcsk7 UTSW 9 45925989 missense probably benign 0.03
R7355:Pcsk7 UTSW 9 45909374 missense probably benign 0.03
R7475:Pcsk7 UTSW 9 45927625 missense probably damaging 1.00
R7540:Pcsk7 UTSW 9 45927673 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGGTTGGGAAACATGGTCTC -3'
(R):5'- GTTGGTGTGGAGGACAATCC -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- TGGAGGACAATCCAGCTCTG -3'
Posted On2014-10-02