Incidental Mutation 'R2182:Dtx4'
ID 237266
Institutional Source Beutler Lab
Gene Symbol Dtx4
Ensembl Gene ENSMUSG00000039982
Gene Name deltex 4, E3 ubiquitin ligase
Synonyms RNF155
MMRRC Submission 040184-MU
Accession Numbers

Genbank: NM_001047855

Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R2182 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 12466341-12501996 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 12483107 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 384 (G384V)
Ref Sequence ENSEMBL: ENSMUSP00000040229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045521]
AlphaFold Q6PDK8
Predicted Effect probably null
Transcript: ENSMUST00000045521
AA Change: G384V

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040229
Gene: ENSMUSG00000039982
AA Change: G384V

DomainStartEndE-ValueType
WWE 5 86 1.38e-38 SMART
WWE 88 163 6.72e-28 SMART
low complexity region 175 192 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
RING 406 464 2.2e-6 SMART
Blast:RING 510 532 3e-7 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A G 9: 53,422,943 H17R probably damaging Het
Abca15 G A 7: 120,340,227 W281* probably null Het
Aloxe3 G A 11: 69,129,600 V157M possibly damaging Het
Arhgap26 G T 18: 39,357,809 probably benign Het
Atp7b T C 8: 22,014,547 N698S probably damaging Het
Casc4 A G 2: 121,867,428 D75G probably damaging Het
Clec4a4 A G 6: 123,013,757 probably null Het
Clgn C T 8: 83,410,410 T252I possibly damaging Het
Cyp2a12 A T 7: 27,031,146 N179Y probably damaging Het
D630045J12Rik C T 6: 38,174,147 probably null Het
Dennd5a G T 7: 109,933,994 R190S probably benign Het
Dxo T C 17: 34,838,892 V191A probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fntb A G 12: 76,862,535 N99S probably benign Het
Gm5773 T A 3: 93,773,513 I164K probably benign Het
Hyal5 T C 6: 24,877,880 I325T probably damaging Het
Igsf8 G A 1: 172,290,728 probably null Het
Lamc2 A G 1: 153,126,866 V17A possibly damaging Het
Lpxn T C 19: 12,832,758 probably null Het
Macf1 A G 4: 123,492,671 V1296A probably damaging Het
Mpdz A T 4: 81,348,722 L318Q probably damaging Het
Mpl T A 4: 118,457,413 Q13L probably benign Het
Mpnd A G 17: 56,015,964 S399G probably benign Het
Mrps5 T C 2: 127,602,487 L347P probably damaging Het
Naip1 T A 13: 100,413,680 Q1217H probably benign Het
Nav2 G A 7: 49,597,254 V2176I probably benign Het
Olfr1341 T C 4: 118,710,345 *313R probably null Het
Olfr853 T C 9: 19,537,342 N196S probably benign Het
Olfr902 A G 9: 38,449,124 N84S probably benign Het
Olfr957 A T 9: 39,511,426 M98K probably damaging Het
Pbx2 C A 17: 34,595,666 Y324* probably null Het
Pcsk7 T A 9: 45,928,619 C702S probably benign Het
Pramef6 T A 4: 143,897,190 H138L possibly damaging Het
Rictor T C 15: 6,772,204 S458P probably damaging Het
Rnf219 A G 14: 104,506,176 S156P possibly damaging Het
Scaf4 T C 16: 90,230,140 M905V probably benign Het
Scarf2 T C 16: 17,803,022 C185R probably damaging Het
Scd1 T G 19: 44,403,293 I101L probably benign Het
Slc6a2 A G 8: 92,961,248 M1V probably null Het
Sost T C 11: 101,963,850 Y211C probably damaging Het
Sphkap A G 1: 83,276,684 S828P probably damaging Het
Tnn T C 1: 160,140,600 probably null Het
Tnrc18 T C 5: 142,760,061 K1319R unknown Het
Vmn2r60 A G 7: 42,195,507 T765A probably benign Het
Vmn2r91 C A 17: 18,105,429 T103K possibly damaging Het
Zbtb44 T C 9: 31,066,676 C429R possibly damaging Het
Zc3h4 G A 7: 16,422,516 G327D unknown Het
Zfp292 A G 4: 34,807,417 C1876R probably damaging Het
Zfp839 C T 12: 110,868,338 L676F probably damaging Het
Zg16 A G 7: 127,050,372 L139P probably damaging Het
Zscan12 A G 13: 21,368,791 I262V probably benign Het
Other mutations in Dtx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Dtx4 APN 19 12478215 missense possibly damaging 0.88
IGL02173:Dtx4 APN 19 12473257 nonsense probably null
IGL03127:Dtx4 APN 19 12486500 splice site probably benign
G5030:Dtx4 UTSW 19 12469579 missense probably benign 0.07
R0143:Dtx4 UTSW 19 12486482 missense probably damaging 0.98
R0932:Dtx4 UTSW 19 12492151 missense probably benign
R1066:Dtx4 UTSW 19 12501009 missense probably damaging 0.98
R2155:Dtx4 UTSW 19 12485282 nonsense probably null
R2362:Dtx4 UTSW 19 12492535 missense probably damaging 1.00
R3880:Dtx4 UTSW 19 12486456 missense probably benign 0.01
R4108:Dtx4 UTSW 19 12501123 missense probably damaging 0.96
R4361:Dtx4 UTSW 19 12485296 missense probably benign 0.04
R4943:Dtx4 UTSW 19 12501060 missense probably damaging 1.00
R5361:Dtx4 UTSW 19 12485262 critical splice donor site probably null
R5440:Dtx4 UTSW 19 12492317 missense probably damaging 1.00
R5613:Dtx4 UTSW 19 12485403 missense probably damaging 0.97
R5614:Dtx4 UTSW 19 12482183 missense probably damaging 1.00
R5703:Dtx4 UTSW 19 12482210 missense possibly damaging 0.84
R5994:Dtx4 UTSW 19 12501153 missense probably damaging 1.00
R6695:Dtx4 UTSW 19 12473235 nonsense probably null
R7107:Dtx4 UTSW 19 12473260 nonsense probably null
R7208:Dtx4 UTSW 19 12482073 critical splice donor site probably null
R7231:Dtx4 UTSW 19 12469658 nonsense probably null
R7521:Dtx4 UTSW 19 12492497 missense probably benign 0.30
R7609:Dtx4 UTSW 19 12492281 missense probably damaging 1.00
R7721:Dtx4 UTSW 19 12482136 missense probably benign 0.09
R7775:Dtx4 UTSW 19 12492010 missense probably benign 0.02
R8685:Dtx4 UTSW 19 12469631 missense probably benign 0.36
Z1176:Dtx4 UTSW 19 12491909 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGGACTTAGGAAACAGTACC -3'
(R):5'- TGCCATCTGCCTTGGGTATG -3'

Sequencing Primer
(F):5'- TTAGGAAACAGTACCTGCCATGTC -3'
(R):5'- CACAGGTTTCCAGGGATCAACTTAG -3'
Posted On 2014-10-02