Mutagenetix > Incidental Mutations

Incidental Mutation 'R2205:Ankrd2'

239013

Institutional Source

Beutler Lab

Gene Symbol

Ankrd2

Ensembl Gene

ENSMUSG00000025172

Gene Name

ankyrin repeat domain 2 (stretch responsive muscle)

Synonyms

mArpp, Arpp

MMRRC Submission

040207-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2205 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42036038-42045110 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 42044119 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 273 (A273E)

Ref Sequence

ENSEMBL: ENSMUSP00000026172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026172] [ENSMUST00000081714] [ENSMUST00000172244]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026172
AA Change: A273E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000026172
Gene: ENSMUSG00000025172
AA Change: A273E

Domain	Start	End	E-Value	Type
low complexity region	104	111	N/A	INTRINSIC
ANK	149	178	5.24e-4	SMART
ANK	182	211	5.79e-6	SMART
ANK	215	244	1.33e-5	SMART
ANK	248	277	3.18e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000081714

SMART Domains

Protein: ENSMUSP00000080414
Gene: ENSMUSG00000025176

Domain	Start	End	E-Value	Type
DHDPS	28	319	8.34e-81	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167381

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168414

Predicted Effect

probably benign
Transcript: ENSMUST00000172244

SMART Domains

Protein: ENSMUSP00000126037
Gene: ENSMUSG00000025176

Domain	Start	End	E-Value	Type
Pfam:DHDPS	57	156	5.8e-11	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the muscle ankyrin repeat protein (MARP) family. A similar gene in rodents is a component of a muscle stress response pathway and plays a role in the stretch-response associated with slow muscle function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and free of cardiac defects but exhibit altered inflammatory responses and are prone to skeletal muscle fiber-type switching of slow fibers toward a faster phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
5830473C10Rik	A	G	5: 90,569,562	T201A	possibly damaging	Het
9930111J21Rik2	C	G	11: 49,019,322	L761F	probably damaging	Het
Abca14	T	C	7: 120,247,280	S652P	probably damaging	Het
Acsl6	G	A	11: 54,324,007	G75S	probably damaging	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ahdc1	A	G	4: 133,065,909	E1487G	possibly damaging	Het
Aknad1	A	G	3: 108,757,293	D406G	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Arhgap35	A	T	7: 16,498,025		probably null	Het
Bag6	G	A	17: 35,144,607	G751R	probably damaging	Het
Brat1	G	A	5: 140,705,133		probably benign	Het
Cacna1h	C	T	17: 25,380,260	A1742T	probably damaging	Het
Catsperg1	G	A	7: 29,185,246	Q922*	probably null	Het
Cfap221	T	G	1: 119,936,104	Y570S	possibly damaging	Het
Cfap45	T	C	1: 172,532,161	V76A	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cpd	A	G	11: 76,802,244	Y739H	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Dhrs7	A	T	12: 72,656,370	V188E	probably damaging	Het
Dpp9	A	C	17: 56,199,287	I411S	possibly damaging	Het
Fitm2	G	A	2: 163,472,596		probably benign	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Gm12169	A	G	11: 46,528,567	N70S	probably benign	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Gpatch1	C	A	7: 35,291,772	D616Y	probably damaging	Het
Gpc3	T	A	X: 52,397,206	I344F	probably damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Hoxb3	T	A	11: 96,345,668	S191T	probably benign	Het
Ifit1bl1	C	T	19: 34,594,341	E239K	probably benign	Het
Ints8	A	T	4: 11,225,712	M615K	possibly damaging	Het
Irak1	G	A	X: 74,017,138	T193I	probably damaging	Het
Megf8	C	T	7: 25,341,748	T1134I	probably benign	Het
Nipsnap1	C	A	11: 4,889,974	H232N	possibly damaging	Het
Nme4	A	T	17: 26,092,140	H150Q	possibly damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
P2rx7	T	A	5: 122,681,101	Y529N	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pofut1	T	A	2: 153,261,247	M267K	probably damaging	Het
Rad54l2	T	C	9: 106,717,798	D320G	probably damaging	Het
Rdm1	C	A	11: 101,634,803	A225E	probably damaging	Het
Samm50	G	A	15: 84,202,314	A245T	probably benign	Het
Scfd2	A	T	5: 74,225,367	M597K	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Skiv2l2	T	C	13: 112,898,890	I510V	probably benign	Het
Ssh3	A	G	19: 4,269,073	L3P	probably damaging	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Tbc1d31	A	G	15: 57,953,520	D717G	probably benign	Het
Tma7	C	A	9: 109,082,226		probably benign	Het
Tmc1	A	T	19: 20,940,905	L2M	probably benign	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Tns3	T	C	11: 8,531,719	Y211C	probably damaging	Het
Ttc21b	C	T	2: 66,235,123	G436S	possibly damaging	Het
Ttn	T	C	2: 76,851,563		probably benign	Het
Ube3b	G	A	5: 114,389,074	V118M	probably damaging	Het
Usp34	A	G	11: 23,385,147	T1210A	probably damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Vmn2r104	A	T	17: 20,029,821	N729K	probably benign	Het
Wdr62	T	A	7: 30,258,149		probably null	Het
Ywhah	A	G	5: 33,027,140	N229S	probably damaging	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zfyve27	C	A	19: 42,183,446	A139D	probably damaging	Het
Zmat1	A	G	X: 134,973,112	L476P	possibly damaging	Het
Zswim4	G	T	8: 84,225,869	T488N	possibly damaging	Het

Other mutations in Ankrd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01529:Ankrd2	APN	19	42039910	missense	probably damaging	0.97
IGL03088:Ankrd2	APN	19	42041985	missense	probably null	0.01
IGL03050:Ankrd2	UTSW	19	42040094	missense	probably damaging	1.00
R0133:Ankrd2	UTSW	19	42044071	missense	probably benign	0.01
R0930:Ankrd2	UTSW	19	42043853	critical splice donor site	probably null
R2135:Ankrd2	UTSW	19	42044059	missense	probably damaging	1.00
R2204:Ankrd2	UTSW	19	42044119	missense	probably damaging	0.98
R4529:Ankrd2	UTSW	19	42043801	missense	probably benign	0.05
R4833:Ankrd2	UTSW	19	42043857	splice site	probably null
R5112:Ankrd2	UTSW	19	42039887	missense	possibly damaging	0.71
R6005:Ankrd2	UTSW	19	42040115	missense	probably damaging	1.00
R6146:Ankrd2	UTSW	19	42040105	missense	possibly damaging	0.57
R7382:Ankrd2	UTSW	19	42044972	missense
R7556:Ankrd2	UTSW	19	42040400	missense
X0063:Ankrd2	UTSW	19	42042403	missense	probably benign	0.01
Z1177:Ankrd2	UTSW	19	42040159	missense
Z1177:Ankrd2	UTSW	19	42044999	missense

Predicted Primers

PCR Primer
(F):5'- TGTAACAGCAGCCTACCAGG -3'
(R):5'- TTGGGCCTTGACACATGAAG -3'

Sequencing Primer
(F):5'- GCGAGTAGTCCTTCCTTACAGG -3'
(R):5'- CCTTGACACATGAAGGGAGAC -3'

Posted On

2014-10-02