Incidental Mutation 'R2227:Cct2'
ID239798
Institutional Source Beutler Lab
Gene Symbol Cct2
Ensembl Gene ENSMUSG00000034024
Gene Namechaperonin containing Tcp1, subunit 2 (beta)
SynonymsCctb
MMRRC Submission 040228-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R2227 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location117051001-117063814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117053017 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 526 (R526G)
Ref Sequence ENSEMBL: ENSMUSP00000036288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047672]
Predicted Effect probably null
Transcript: ENSMUST00000047672
AA Change: R526G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000036288
Gene: ENSMUSG00000034024
AA Change: R526G

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 35 525 3.2e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218502
Predicted Effect probably null
Transcript: ENSMUST00000219690
AA Change: S89G
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T A 14: 60,088,219 probably benign Het
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Agl A T 3: 116,788,312 V306D possibly damaging Het
Alpk2 T A 18: 65,378,076 T17S probably damaging Het
Ar T A X: 98,151,331 M517K probably benign Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BB014433 C A 8: 15,041,717 A379S probably benign Het
BC005561 T A 5: 104,519,420 Y603N probably damaging Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Ccl2 G T 11: 82,036,601 probably null Het
Cep55 T C 19: 38,062,634 M164T probably benign Het
Clec2d G A 6: 129,184,251 A104T probably benign Het
Cyp3a11 A G 5: 145,868,547 L220P possibly damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exoc2 T A 13: 30,864,884 I729L probably benign Het
Fbxl20 T C 11: 98,090,849 I338V probably benign Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Gm6614 T G 6: 141,992,361 E277D possibly damaging Het
Gucy2c G A 6: 136,702,760 T943I probably damaging Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17rb A T 14: 30,006,081 S56R probably benign Het
Knl1 A G 2: 119,072,000 D1394G probably damaging Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Krt6b A G 15: 101,679,122 V179A probably damaging Het
Lpar5 A T 6: 125,081,135 probably null Het
March7 A G 2: 60,229,846 R106G probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Myl1 T C 1: 66,944,815 K31E possibly damaging Het
Myt1l T A 12: 29,826,970 L207I unknown Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Pkhd1l1 T C 15: 44,512,792 I950T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Rc3h1 T C 1: 160,963,542 I932T probably benign Het
Rubcnl G A 14: 75,042,392 R405Q probably benign Het
Sgsm3 A G 15: 81,003,868 E53G probably damaging Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn1r86 T C 7: 13,102,920 I10V probably benign Het
Xpot T C 10: 121,622,860 R20G probably damaging Het
Zfp735 T A 11: 73,711,396 L389I possibly damaging Het
Zfp735 T G 11: 73,711,397 L389* probably null Het
Other mutations in Cct2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Cct2 APN 10 117053112 missense probably damaging 0.99
IGL02150:Cct2 APN 10 117062099 missense probably damaging 0.99
IGL02349:Cct2 APN 10 117053139 missense probably benign 0.04
IGL03010:Cct2 APN 10 117058114 missense probably damaging 1.00
IGL03155:Cct2 APN 10 117060671 missense probably damaging 0.99
R0507:Cct2 UTSW 10 117055246 splice site probably null
R0742:Cct2 UTSW 10 117055246 splice site probably null
R1102:Cct2 UTSW 10 117060640 splice site probably null
R1438:Cct2 UTSW 10 117054992 unclassified probably benign
R2040:Cct2 UTSW 10 117053113 missense probably benign 0.00
R2157:Cct2 UTSW 10 117062809 splice site probably benign
R3410:Cct2 UTSW 10 117062063 missense probably benign 0.01
R3981:Cct2 UTSW 10 117054135 missense probably damaging 1.00
R3983:Cct2 UTSW 10 117054135 missense probably damaging 1.00
R4364:Cct2 UTSW 10 117055151 missense probably damaging 1.00
R4401:Cct2 UTSW 10 117057809 missense possibly damaging 0.61
R6162:Cct2 UTSW 10 117058186 missense probably damaging 0.99
R6300:Cct2 UTSW 10 117056159 missense probably damaging 0.96
R6312:Cct2 UTSW 10 117056055 missense probably benign 0.00
R7075:Cct2 UTSW 10 117061465 missense unknown
R7198:Cct2 UTSW 10 117053124 missense probably benign
R7236:Cct2 UTSW 10 117061559 missense probably benign 0.00
R8373:Cct2 UTSW 10 117060824 missense possibly damaging 0.95
R8803:Cct2 UTSW 10 117058185 missense probably benign 0.00
R8859:Cct2 UTSW 10 117060834 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GGCTACCCAAACCAGTTTCC -3'
(R):5'- TCTAGCTAAATCAGGCAGTGAGATG -3'

Sequencing Primer
(F):5'- CTCCTATGCCTTTCTAAGAACTACG -3'
(R):5'- CAGTGAGATGCAGTAACAGCTTTAG -3'
Posted On2014-10-15