Incidental Mutation 'R2286:Slc39a5'
ID243306
Institutional Source Beutler Lab
Gene Symbol Slc39a5
Ensembl Gene ENSMUSG00000039878
Gene Namesolute carrier family 39 (metal ion transporter), member 5
SynonymsZip5, 2010205A06Rik, 1810013D05Rik
MMRRC Submission 040285-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2286 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128395931-128401229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128396060 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 532 (V532A)
Ref Sequence ENSEMBL: ENSMUSP00000131736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014642] [ENSMUST00000042666] [ENSMUST00000167859] [ENSMUST00000218858] [ENSMUST00000219131]
Predicted Effect probably benign
Transcript: ENSMUST00000014642
SMART Domains Protein: ENSMUSP00000014642
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 7 36 4.44e2 SMART
ANK 40 69 6.55e-5 SMART
ANK 73 102 1.03e-2 SMART
ANK 106 135 1.5e1 SMART
ANK 139 168 5.49e-7 SMART
ANK 172 201 3.01e-4 SMART
ANK 205 234 1.2e-3 SMART
ANK 238 267 2.62e-4 SMART
ANK 271 301 9.78e-4 SMART
ANK 305 334 3.85e-2 SMART
ANK 338 367 5.62e-4 SMART
ANK 371 402 1.55e2 SMART
ANK 422 451 2.16e-5 SMART
ANK 455 484 3.28e-5 SMART
ANK 488 545 2.79e1 SMART
ANK 549 578 5.45e-2 SMART
ANK 584 613 1.84e1 SMART
ANK 617 646 3.85e-2 SMART
ANK 651 682 2.1e-3 SMART
ANK 687 716 6.76e-7 SMART
ANK 720 749 1.07e0 SMART
ANK 753 784 2.92e-2 SMART
ANK 790 819 1.12e-3 SMART
ANK 822 853 9.75e1 SMART
ANK 857 886 1.99e-4 SMART
ANK 890 920 5.09e-2 SMART
ANK 924 953 2.54e-2 SMART
ANK 960 989 1.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042666
AA Change: V532A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037753
Gene: ENSMUSG00000039878
AA Change: V532A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 2.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166577
SMART Domains Protein: ENSMUSP00000128794
Gene: ENSMUSG00000014498

DomainStartEndE-ValueType
ANK 18 48 5.09e-2 SMART
ANK 52 81 2.54e-2 SMART
ANK 88 117 1.34e-1 SMART
Blast:ANK 121 148 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167226
Predicted Effect probably benign
Transcript: ENSMUST00000167859
AA Change: V532A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131736
Gene: ENSMUSG00000039878
AA Change: V532A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Pfam:Zip 208 522 3.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218858
Predicted Effect probably benign
Transcript: ENSMUST00000219131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219222
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ZIP family of zinc transporters that transport zinc into cells from outside, and play a crucial role in controlling intracellular zinc levels. Zinc is an essential cofactor for many enzymes and proteins involved in gene transcription, growth, development and differentiation. Mutations in this gene have been associated with autosomal dominant high myopia (MYP24). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered zinc homeostasis and increased susceptibility to zinc-induced pancretitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,145,616 R308H probably damaging Het
Alox5ap G A 5: 149,285,430 probably null Het
Ap2s1 T C 7: 16,748,976 V131A possibly damaging Het
Cdr2l GAA GA 11: 115,392,800 probably null Het
Cpsf7 T C 19: 10,535,296 L248P probably damaging Het
Dscr3 C T 16: 94,512,253 E60K possibly damaging Het
Dtd1 T C 2: 144,635,866 probably null Het
Eci1 A G 17: 24,433,229 D75G probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Luc7l A G 17: 26,280,046 probably benign Het
Med13 A C 11: 86,319,689 D542E probably benign Het
Myo6 T C 9: 80,266,212 S545P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1281 A G 2: 111,328,907 I163V probably benign Het
Rsad2 T A 12: 26,450,676 N204I probably benign Het
Setd5 T G 6: 113,119,610 N592K possibly damaging Het
Sgip1 G T 4: 102,867,647 S59I possibly damaging Het
Smarcc2 G A 10: 128,463,743 M123I possibly damaging Het
Tdrd1 A G 19: 56,839,119 T185A probably benign Het
Tnn T C 1: 160,110,509 E1146G possibly damaging Het
Unc13a T C 8: 71,630,559 K1618E probably damaging Het
Vmn2r120 A G 17: 57,508,958 L799P probably damaging Het
Other mutations in Slc39a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02535:Slc39a5 APN 10 128399330 missense probably benign 0.00
IGL02666:Slc39a5 APN 10 128398455 missense probably damaging 1.00
R0305:Slc39a5 UTSW 10 128398396 unclassified probably benign
R0350:Slc39a5 UTSW 10 128396750 critical splice donor site probably null
R0437:Slc39a5 UTSW 10 128399847 missense possibly damaging 0.94
R1401:Slc39a5 UTSW 10 128397741 missense probably damaging 1.00
R2025:Slc39a5 UTSW 10 128398410 missense probably damaging 1.00
R2025:Slc39a5 UTSW 10 128398411 missense probably damaging 1.00
R4041:Slc39a5 UTSW 10 128396468 missense possibly damaging 0.95
R4649:Slc39a5 UTSW 10 128397267 missense probably benign 0.00
R4776:Slc39a5 UTSW 10 128397049 missense probably damaging 0.98
R4890:Slc39a5 UTSW 10 128398447 missense probably benign 0.13
R5911:Slc39a5 UTSW 10 128399943 missense probably damaging 1.00
R6703:Slc39a5 UTSW 10 128397782 missense probably damaging 1.00
R8428:Slc39a5 UTSW 10 128397015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACCTGCTTTGAGCCCTC -3'
(R):5'- AGGTCTTGCCTCAAACGTAG -3'

Sequencing Primer
(F):5'- ACCACACCCCGGTTTTCTATG -3'
(R):5'- GTCTTGCCTCAAACGTAGGTAAATAG -3'
Posted On2014-10-16