Mutagenetix > Incidental Mutations

Incidental Mutation 'R2286:Rsad2'

243311

Institutional Source

Beutler Lab

Gene Symbol

Rsad2

Ensembl Gene

ENSMUSG00000020641

Gene Name

radical S-adenosyl methionine domain containing 2

Synonyms

viperin, cig5, Vig1, 2510004L01Rik

MMRRC Submission

040285-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2286 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26442746-26456452 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 26450676 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 204 (N204I)

Ref Sequence

ENSEMBL: ENSMUSP00000020970 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020970] [ENSMUST00000137792]

Predicted Effect

probably benign
Transcript: ENSMUST00000020970
AA Change: N204I

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000020970
Gene: ENSMUSG00000020641
AA Change: N204I

Domain	Start	End	E-Value	Type
low complexity region	13	28	N/A	INTRINSIC
Elp3	74	282	8.55e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000137792

SMART Domains

Protein: ENSMUSP00000121791
Gene: ENSMUSG00000020641

Domain	Start	End	E-Value	Type
low complexity region	13	28	N/A	INTRINSIC
Pfam:Fer4_12	69	174	1.3e-10	PFAM
Pfam:Fer4_14	78	172	7.7e-11	PFAM
Pfam:Radical_SAM	78	178	9.5e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142732

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit impaired T-helper 2 differentitation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	C	T	5: 8,145,616	R308H	probably damaging	Het
Alox5ap	G	A	5: 149,285,430		probably null	Het
Ap2s1	T	C	7: 16,748,976	V131A	possibly damaging	Het
Cdr2l	GAA	GA	11: 115,392,800		probably null	Het
Cpsf7	T	C	19: 10,535,296	L248P	probably damaging	Het
Dscr3	C	T	16: 94,512,253	E60K	possibly damaging	Het
Dtd1	T	C	2: 144,635,866		probably null	Het
Eci1	A	G	17: 24,433,229	D75G	probably damaging	Het
Kremen1	CGGG	CGGGGGG	11: 5,201,791		probably benign	Het
Luc7l	A	G	17: 26,280,046		probably benign	Het
Med13	A	C	11: 86,319,689	D542E	probably benign	Het
Myo6	T	C	9: 80,266,212	S545P	possibly damaging	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Olfr1281	A	G	2: 111,328,907	I163V	probably benign	Het
Setd5	T	G	6: 113,119,610	N592K	possibly damaging	Het
Sgip1	G	T	4: 102,867,647	S59I	possibly damaging	Het
Slc39a5	A	G	10: 128,396,060	V532A	probably benign	Het
Smarcc2	G	A	10: 128,463,743	M123I	possibly damaging	Het
Tdrd1	A	G	19: 56,839,119	T185A	probably benign	Het
Tnn	T	C	1: 160,110,509	E1146G	possibly damaging	Het
Unc13a	T	C	8: 71,630,559	K1618E	probably damaging	Het
Vmn2r120	A	G	17: 57,508,958	L799P	probably damaging	Het

Other mutations in Rsad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01431:Rsad2	APN	12	26448667	missense	probably benign	0.01
IGL02237:Rsad2	APN	12	26456187	missense	probably damaging	1.00
R0077:Rsad2	UTSW	12	26456377	missense	probably damaging	0.96
R0472:Rsad2	UTSW	12	26454168	missense	possibly damaging	0.87
R1368:Rsad2	UTSW	12	26447148	splice site	probably null
R1392:Rsad2	UTSW	12	26445440	missense	probably benign	0.00
R1392:Rsad2	UTSW	12	26445440	missense	probably benign	0.00
R1393:Rsad2	UTSW	12	26456377	missense	probably damaging	0.96
R1860:Rsad2	UTSW	12	26450617	missense	probably damaging	1.00
R3430:Rsad2	UTSW	12	26456419	start codon destroyed	probably null	0.98
R5304:Rsad2	UTSW	12	26450682	missense	probably damaging	1.00
R6000:Rsad2	UTSW	12	26447151	critical splice donor site	probably null
R6052:Rsad2	UTSW	12	26450578	missense	probably benign	0.02
R6084:Rsad2	UTSW	12	26454123	missense	probably damaging	1.00
R6193:Rsad2	UTSW	12	26456187	missense	probably damaging	1.00
R7019:Rsad2	UTSW	12	26456419	start codon destroyed	possibly damaging	0.89
R7158:Rsad2	UTSW	12	26450780	splice site	probably null
R7229:Rsad2	UTSW	12	26454123	missense	probably damaging	1.00
R8330:Rsad2	UTSW	12	26456406	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCCAGAATCCTCAGTGTTCC -3'
(R):5'- GAGGCATACATGACATCCAGG -3'

Sequencing Primer
(F):5'- ACTGAGCCAAGTTTCCTGAG -3'
(R):5'- TACATGACATCCAGGACTCAGGG -3'

Posted On

2014-10-16