Incidental Mutation 'R2286:Rsad2'
ID243311
Institutional Source Beutler Lab
Gene Symbol Rsad2
Ensembl Gene ENSMUSG00000020641
Gene Nameradical S-adenosyl methionine domain containing 2
Synonymsviperin, cig5, Vig1, 2510004L01Rik
MMRRC Submission 040285-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2286 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location26442746-26456452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26450676 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 204 (N204I)
Ref Sequence ENSEMBL: ENSMUSP00000020970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020970] [ENSMUST00000137792]
Predicted Effect probably benign
Transcript: ENSMUST00000020970
AA Change: N204I

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020970
Gene: ENSMUSG00000020641
AA Change: N204I

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Elp3 74 282 8.55e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137792
SMART Domains Protein: ENSMUSP00000121791
Gene: ENSMUSG00000020641

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Fer4_12 69 174 1.3e-10 PFAM
Pfam:Fer4_14 78 172 7.7e-11 PFAM
Pfam:Radical_SAM 78 178 9.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142732
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit impaired T-helper 2 differentitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C T 5: 8,145,616 R308H probably damaging Het
Alox5ap G A 5: 149,285,430 probably null Het
Ap2s1 T C 7: 16,748,976 V131A possibly damaging Het
Cdr2l GAA GA 11: 115,392,800 probably null Het
Cpsf7 T C 19: 10,535,296 L248P probably damaging Het
Dscr3 C T 16: 94,512,253 E60K possibly damaging Het
Dtd1 T C 2: 144,635,866 probably null Het
Eci1 A G 17: 24,433,229 D75G probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Luc7l A G 17: 26,280,046 probably benign Het
Med13 A C 11: 86,319,689 D542E probably benign Het
Myo6 T C 9: 80,266,212 S545P possibly damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1281 A G 2: 111,328,907 I163V probably benign Het
Setd5 T G 6: 113,119,610 N592K possibly damaging Het
Sgip1 G T 4: 102,867,647 S59I possibly damaging Het
Slc39a5 A G 10: 128,396,060 V532A probably benign Het
Smarcc2 G A 10: 128,463,743 M123I possibly damaging Het
Tdrd1 A G 19: 56,839,119 T185A probably benign Het
Tnn T C 1: 160,110,509 E1146G possibly damaging Het
Unc13a T C 8: 71,630,559 K1618E probably damaging Het
Vmn2r120 A G 17: 57,508,958 L799P probably damaging Het
Other mutations in Rsad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Rsad2 APN 12 26448667 missense probably benign 0.01
IGL02237:Rsad2 APN 12 26456187 missense probably damaging 1.00
R0077:Rsad2 UTSW 12 26456377 missense probably damaging 0.96
R0472:Rsad2 UTSW 12 26454168 missense possibly damaging 0.87
R1368:Rsad2 UTSW 12 26447148 splice site probably null
R1392:Rsad2 UTSW 12 26445440 missense probably benign 0.00
R1392:Rsad2 UTSW 12 26445440 missense probably benign 0.00
R1393:Rsad2 UTSW 12 26456377 missense probably damaging 0.96
R1860:Rsad2 UTSW 12 26450617 missense probably damaging 1.00
R3430:Rsad2 UTSW 12 26456419 start codon destroyed probably null 0.98
R5304:Rsad2 UTSW 12 26450682 missense probably damaging 1.00
R6000:Rsad2 UTSW 12 26447151 critical splice donor site probably null
R6052:Rsad2 UTSW 12 26450578 missense probably benign 0.02
R6084:Rsad2 UTSW 12 26454123 missense probably damaging 1.00
R6193:Rsad2 UTSW 12 26456187 missense probably damaging 1.00
R7019:Rsad2 UTSW 12 26456419 start codon destroyed possibly damaging 0.89
R7158:Rsad2 UTSW 12 26450780 splice site probably null
R7229:Rsad2 UTSW 12 26454123 missense probably damaging 1.00
R8330:Rsad2 UTSW 12 26456406 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCAGAATCCTCAGTGTTCC -3'
(R):5'- GAGGCATACATGACATCCAGG -3'

Sequencing Primer
(F):5'- ACTGAGCCAAGTTTCCTGAG -3'
(R):5'- TACATGACATCCAGGACTCAGGG -3'
Posted On2014-10-16