Incidental Mutation 'R2368:Zbtb12'
ID246414
Institutional Source Beutler Lab
Gene Symbol Zbtb12
Ensembl Gene ENSMUSG00000049823
Gene Namezinc finger and BTB domain containing 12
SynonymsBat-9, Bat9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R2368 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34879483-34896867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34895698 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 153 (L153P)
Ref Sequence ENSEMBL: ENSMUSP00000057515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013931] [ENSMUST00000052778] [ENSMUST00000078061] [ENSMUST00000097342] [ENSMUST00000114033] [ENSMUST00000148431] [ENSMUST00000173093]
Predicted Effect probably benign
Transcript: ENSMUST00000013931
SMART Domains Protein: ENSMUSP00000013931
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 604 627 N/A INTRINSIC
ANK 737 766 2.52e-6 SMART
ANK 770 799 1.19e-2 SMART
ANK 803 833 4.71e-6 SMART
ANK 837 866 2.9e-6 SMART
ANK 870 899 1e0 SMART
ANK 903 932 1.53e-5 SMART
PreSET 976 1075 2.44e-40 SMART
SET 1091 1214 4.08e-46 SMART
PostSET 1217 1233 2.84e-1 SMART
low complexity region 1245 1260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000052778
AA Change: L153P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057515
Gene: ENSMUSG00000049823
AA Change: L153P

DomainStartEndE-ValueType
BTB 33 127 1.5e-19 SMART
low complexity region 138 149 N/A INTRINSIC
low complexity region 153 179 N/A INTRINSIC
low complexity region 186 204 N/A INTRINSIC
low complexity region 227 241 N/A INTRINSIC
low complexity region 297 327 N/A INTRINSIC
ZnF_C2H2 333 356 4.4e-2 SMART
ZnF_C2H2 359 381 2.27e-4 SMART
ZnF_C2H2 387 409 1.25e-1 SMART
ZnF_C2H2 415 438 4.54e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078061
SMART Domains Protein: ENSMUSP00000077208
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
ANK 646 675 2.52e-6 SMART
ANK 679 708 1.19e-2 SMART
ANK 712 742 4.71e-6 SMART
ANK 746 775 2.9e-6 SMART
ANK 779 808 1e0 SMART
ANK 812 841 1.53e-5 SMART
PreSET 885 984 2.44e-40 SMART
SET 1000 1123 4.08e-46 SMART
PostSET 1126 1142 2.84e-1 SMART
low complexity region 1154 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097342
SMART Domains Protein: ENSMUSP00000094955
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
ANK 703 732 2.52e-6 SMART
ANK 736 765 1.19e-2 SMART
ANK 769 799 4.71e-6 SMART
ANK 803 832 2.9e-6 SMART
ANK 836 865 1e0 SMART
ANK 869 898 1.53e-5 SMART
PreSET 942 1041 2.44e-40 SMART
SET 1057 1180 4.08e-46 SMART
PostSET 1183 1199 2.84e-1 SMART
low complexity region 1211 1226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114033
SMART Domains Protein: ENSMUSP00000109667
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
ANK 680 709 2.52e-6 SMART
ANK 713 742 1.19e-2 SMART
ANK 746 776 4.71e-6 SMART
ANK 780 809 2.9e-6 SMART
ANK 813 842 1e0 SMART
ANK 846 875 1.53e-5 SMART
PreSET 919 1018 2.44e-40 SMART
SET 1034 1157 4.08e-46 SMART
PostSET 1160 1176 2.84e-1 SMART
low complexity region 1188 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146418
Predicted Effect probably benign
Transcript: ENSMUST00000148431
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173093
SMART Domains Protein: ENSMUSP00000133903
Gene: ENSMUSG00000049823

DomainStartEndE-ValueType
Pfam:BTB 23 68 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174880
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,350,012 K102E possibly damaging Het
Bsn G A 9: 108,111,030 Q2508* probably null Het
Cc2d2a A G 5: 43,703,888 T549A probably benign Het
Lyst A T 13: 13,696,663 S2662C probably damaging Het
Nek9 A G 12: 85,329,887 V240A possibly damaging Het
Nol4l T C 2: 153,418,039 D165G probably damaging Het
Olfr1098 A T 2: 86,923,107 Y142N probably benign Het
Olfr126 A T 17: 37,850,618 M9L probably benign Het
Olfr1335 A G 4: 118,809,822 V14A probably benign Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Plin5 T C 17: 56,115,588 E116G probably damaging Het
Slc35d2 C T 13: 64,129,305 M1I probably null Het
Srgap1 A T 10: 121,829,289 S493T probably benign Het
Syt9 T A 7: 107,436,699 Y308N probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r74 C T 7: 85,961,314 D57N probably benign Het
Vstm5 A T 9: 15,257,731 M166L probably benign Het
Other mutations in Zbtb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02290:Zbtb12 APN 17 34895472 missense probably damaging 0.98
R0445:Zbtb12 UTSW 17 34896301 missense possibly damaging 0.83
R1027:Zbtb12 UTSW 17 34896308 frame shift probably null
R1673:Zbtb12 UTSW 17 34896308 frame shift probably null
R1673:Zbtb12 UTSW 17 34896310 frame shift probably null
R2880:Zbtb12 UTSW 17 34895479 missense probably damaging 0.99
R3908:Zbtb12 UTSW 17 34896268 splice site probably null
R4705:Zbtb12 UTSW 17 34896401 missense possibly damaging 0.93
R4707:Zbtb12 UTSW 17 34895499 missense probably damaging 0.97
R4837:Zbtb12 UTSW 17 34896009 missense probably benign
R5665:Zbtb12 UTSW 17 34895883 missense possibly damaging 0.93
V5088:Zbtb12 UTSW 17 34896301 missense possibly damaging 0.83
V5622:Zbtb12 UTSW 17 34896301 missense possibly damaging 0.83
V5622:Zbtb12 UTSW 17 34896301 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TATTGTGGCGGACTTGCTCC -3'
(R):5'- CTTTGACGATGCAGATGTCAGAAAC -3'

Sequencing Primer
(F):5'- TCTTGCTACACAGGCGC -3'
(R):5'- GTCAGAAACATCTTCATCTTCATCC -3'
Posted On2014-10-30