Mutagenetix > Incidental Mutation

Incidental Mutation 'R9403:Slc5a7'

711367

Institutional Source

Beutler Lab

Gene Symbol

Slc5a7

Ensembl Gene

ENSMUSG00000023945

Gene Name

solute carrier family 5 (choline transporter), member 7

Synonyms

CHT1

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9403 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

54273594-54299034 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 54276641 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 540 (N540K)

Ref Sequence

ENSEMBL: ENSMUSP00000093379 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095712]

AlphaFold

Q8BGY9

Predicted Effect

probably benign
Transcript: ENSMUST00000095712
AA Change: N540K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000093379
Gene: ENSMUSG00000023945
AA Change: N540K

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:SSF	42	442	4.7e-36	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium ion- and chloride ion-dependent high-affinity transporter that mediates choline uptake for acetylcholine synthesis in cholinergic neurons. The protein transports choline from the extracellular space into presynaptic terminals for synthesis into acetylcholine. Increased choline uptake results from increased density of this protein in synaptosomal plasma membranes in response to depolarization of cholinergic terminals. Dysfunction of cholinergic signaling has been implicated in various disorders including depression, attention-deficit disorder, and schizophrenia. An allelic variant of this gene is associated with autosomal dominant distal hereditary motor neuronopathy type VIIA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display neonatal lethality with respiratory failure, hyporesponsiveness to touch, inability to sustain acetylcholine release, and abnormal neuromuscular junction morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	G	6: 96,165,299	T255P	probably benign	Het
4930444G20Rik	C	T	10: 22,067,941	D47N	possibly damaging	Het
Angpt4	C	T	2: 151,938,972	T380M	probably damaging	Het
Apoa5	G	C	9: 46,270,646	R340P	probably damaging	Het
Cyp3a41a	T	A	5: 145,702,198	Y320F	probably damaging	Het
Dmtf1	A	G	5: 9,121,927	L503S	possibly damaging	Het
Dock1	T	C	7: 135,168,396	V1795A	probably benign	Het
Dpys	C	G	15: 39,828,071	W285S	probably damaging	Het
Fam187b	T	C	7: 30,977,090	V8A		Het
Fbn2	T	C	18: 58,066,107	E1363G	probably damaging	Het
Glg1	C	T	8: 111,187,793	R453Q	probably benign	Het
Gm5591	T	A	7: 38,520,148	M434L	probably benign	Het
Gm5591	T	C	7: 38,522,256	T130A	probably damaging	Het
Gpld1	G	A	13: 24,979,729	V502I	probably benign	Het
Inhba	A	G	13: 16,017,381	H29R	probably benign	Het
Itga4	T	A	2: 79,325,660	I990N	possibly damaging	Het
Kcnma1	T	A	14: 23,543,077	I280L	probably benign	Het
Malrd1	T	C	2: 15,614,177	V284A		Het
Maml2	C	T	9: 13,621,673	Q728*	probably null	Het
Mkln1	T	C	6: 31,432,970	L181P	probably damaging	Het
Mms22l	T	C	4: 24,580,204		probably null	Het
Muc16	A	G	9: 18,537,764		probably null	Het
Mylk	C	A	16: 34,875,642	S249*	probably null	Het
Naa35	G	A	13: 59,601,003	A150T	possibly damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Nup205	G	A	6: 35,199,974	R635H	probably benign	Het
Olfr263	T	C	13: 21,133,695	F307L	probably benign	Het
Olfr723	T	C	14: 49,929,449	T32A	probably benign	Het
Padi3	T	C	4: 140,810,532	I26V	probably benign	Het
Polq	T	C	16: 37,061,853	S1460P	probably benign	Het
Ptgdr	A	G	14: 44,853,258	S348P		Het
Qsox1	A	G	1: 155,782,597	S409P	probably damaging	Het
Rergl	T	A	6: 139,494,854	Y99F	possibly damaging	Het
Rptn	C	A	3: 93,395,042	H22N	probably benign	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Sh2b1	GGACCAGCTCAG	GGACCAGCTCAGTCACGGTGACCAGCTCAG	7: 126,467,573		probably null	Het
Sh2b1	ACCAGCTCAGCCACGGGG	ACCAGCTCAGCCACGGGGCCCAGCTCAGCCACGGGG	7: 126,467,575		probably benign	Het
Slc2a3	A	C	6: 122,736,610	I214M	probably damaging	Het
Slco6c1	A	T	1: 97,062,523	S664R	possibly damaging	Het
Tgm4	C	A	9: 123,052,772	S344R	probably damaging	Het
Trim61	T	A	8: 65,014,576	Q11L	probably damaging	Het
Trpm6	C	A	19: 18,832,652	D1137E	possibly damaging	Het
Txndc2	G	A	17: 65,637,997	T395I	probably damaging	Het
Txndc9	T	C	1: 37,995,778	E15G	probably benign	Het
Vcpip1	A	G	1: 9,745,824	I778T	possibly damaging	Het
Zfp383	T	C	7: 29,915,259	F313S	possibly damaging	Het

Other mutations in Slc5a7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01098:Slc5a7	APN	17	54292960	missense	probably benign	0.00
IGL01833:Slc5a7	APN	17	54281833	missense	probably damaging	1.00
IGL02206:Slc5a7	APN	17	54296994	missense	probably damaging	0.98
IGL02493:Slc5a7	APN	17	54293880	missense	probably damaging	1.00
IGL02598:Slc5a7	APN	17	54284193	missense	probably benign
IGL02693:Slc5a7	APN	17	54276919	missense	probably benign	0.00
IGL02896:Slc5a7	APN	17	54293017	nonsense	probably null
R0288:Slc5a7	UTSW	17	54293018	nonsense	probably null
R1137:Slc5a7	UTSW	17	54293011	missense	probably damaging	1.00
R1692:Slc5a7	UTSW	17	54281726	missense	probably damaging	0.99
R1755:Slc5a7	UTSW	17	54292978	missense	probably benign	0.01
R1987:Slc5a7	UTSW	17	54293835	missense	probably damaging	1.00
R2373:Slc5a7	UTSW	17	54277126	missense	probably damaging	1.00
R4170:Slc5a7	UTSW	17	54276858	missense	probably benign	0.08
R4614:Slc5a7	UTSW	17	54276559	missense	probably benign	0.00
R4785:Slc5a7	UTSW	17	54278700	missense	probably damaging	1.00
R4793:Slc5a7	UTSW	17	54281794	missense	possibly damaging	0.95
R4828:Slc5a7	UTSW	17	54276799	missense	probably benign	0.11
R4847:Slc5a7	UTSW	17	54277140	missense	possibly damaging	0.82
R4879:Slc5a7	UTSW	17	54276651	missense	probably benign	0.04
R5152:Slc5a7	UTSW	17	54278833	missense	possibly damaging	0.51
R5171:Slc5a7	UTSW	17	54276676	missense	probably benign
R5196:Slc5a7	UTSW	17	54281722	critical splice donor site	probably null
R5935:Slc5a7	UTSW	17	54276944	nonsense	probably null
R6307:Slc5a7	UTSW	17	54276978	missense	probably benign	0.12
R6354:Slc5a7	UTSW	17	54277033	missense	probably damaging	1.00
R6357:Slc5a7	UTSW	17	54287361	missense	probably benign	0.33
R6395:Slc5a7	UTSW	17	54278821	missense	probably damaging	1.00
R6500:Slc5a7	UTSW	17	54284203	missense	probably benign
R6643:Slc5a7	UTSW	17	54276616	missense	probably benign	0.00
R7062:Slc5a7	UTSW	17	54293001	missense	probably damaging	1.00
R7405:Slc5a7	UTSW	17	54297133	missense	probably benign
R7470:Slc5a7	UTSW	17	54276962	nonsense	probably null
R7477:Slc5a7	UTSW	17	54281759	missense	probably damaging	1.00
R7942:Slc5a7	UTSW	17	54276681	missense	possibly damaging	0.69
R8348:Slc5a7	UTSW	17	54276627	missense	possibly damaging	0.62
R8928:Slc5a7	UTSW	17	54284230	missense	possibly damaging	0.84
R9082:Slc5a7	UTSW	17	54297111	missense	probably benign	0.00
R9192:Slc5a7	UTSW	17	54287361	missense	probably benign	0.33
R9359:Slc5a7	UTSW	17	54276641	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTCCAGTACTACCCTACAGCAATG -3'
(R):5'- AGCCATATCTATACTTGCAGCCC -3'

Sequencing Primer
(F):5'- ACAGCAATGCCCTCTTCTG -3'
(R):5'- ACCCTGGTTATTACTCTGACAAG -3'

Posted On

2022-05-16