Incidental Mutation 'R2420:Psmb10'
ID 249211
Institutional Source Beutler Lab
Gene Symbol Psmb10
Ensembl Gene ENSMUSG00000031897
Gene Name proteasome (prosome, macropain) subunit, beta type 10
Synonyms Mecl-1, Mecl1
MMRRC Submission 040382-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.341) question?
Stock # R2420 (G1)
Quality Score 114
Status Not validated
Chromosome 8
Chromosomal Location 106662360-106665024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106663934 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 108 (S108P)
Ref Sequence ENSEMBL: ENSMUSP00000034369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034368] [ENSMUST00000034369] [ENSMUST00000038896]
AlphaFold O35955
PDB Structure Mouse 20S immunoproteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034368
SMART Domains Protein: ENSMUSP00000034368
Gene: ENSMUSG00000031896

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 33 257 1.41e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034369
AA Change: S108P

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034369
Gene: ENSMUSG00000031897
AA Change: S108P

DomainStartEndE-ValueType
Pfam:Proteasome 36 217 3.9e-49 PFAM
Pfam:Pr_beta_C 231 267 3.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038896
SMART Domains Protein: ENSMUSP00000038232
Gene: ENSMUSG00000035237

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:LCAT 81 414 1.7e-111 PFAM
low complexity region 425 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212561
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. Proteolytic processing is required to generate a mature subunit. Expression of this gene is induced by gamma interferon, and this gene product replaces catalytic subunit 2 (proteasome beta 7 subunit) in the immunoproteasome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice have a reduced number of splenic CD8 T cells with defects in proliferation and an altered T cell receptor repertoire to viral antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,270,921 (GRCm39) K48R probably damaging Het
Acsm2 T C 7: 119,162,857 (GRCm39) F44L probably damaging Het
Actr5 T C 2: 158,478,001 (GRCm39) F457S probably damaging Het
Adamts3 A G 5: 89,831,034 (GRCm39) S1007P probably damaging Het
Ahnak C T 19: 8,986,620 (GRCm39) P2635S possibly damaging Het
Ankrd17 A T 5: 90,437,179 (GRCm39) D555E possibly damaging Het
Arhgap29 A G 3: 121,767,629 (GRCm39) I24V probably benign Het
Atxn2 A T 5: 121,940,142 (GRCm39) probably null Het
Birc6 T A 17: 74,967,609 (GRCm39) L301Q probably damaging Het
Ccdc137 G A 11: 120,353,090 (GRCm39) probably null Het
Ccdc18 A C 5: 108,376,454 (GRCm39) E1298D probably damaging Het
Chst9 A T 18: 15,585,341 (GRCm39) N407K probably damaging Het
Cwf19l2 A G 9: 3,411,341 (GRCm39) K73E possibly damaging Het
Dhcr24 G T 4: 106,418,291 (GRCm39) probably benign Het
Dnajc21 A G 15: 10,462,021 (GRCm39) S127P probably benign Het
Egln1 T C 8: 125,674,985 (GRCm39) N270S probably benign Het
Eme1 A G 11: 94,536,640 (GRCm39) probably null Het
Emilin2 A G 17: 71,581,274 (GRCm39) I484T possibly damaging Het
Entpd2 T C 2: 25,289,295 (GRCm39) I259T probably benign Het
Fbp1 T C 13: 63,019,120 (GRCm39) K24E probably benign Het
Fga A T 3: 82,940,461 (GRCm39) N705I possibly damaging Het
Gas1 G T 13: 60,324,744 (GRCm39) probably benign Het
Glrb A G 3: 80,767,542 (GRCm39) I226T probably damaging Het
Gm17421 T A 12: 113,333,107 (GRCm39) noncoding transcript Het
Gm44501 A T 17: 40,889,600 (GRCm39) H38L possibly damaging Het
H2-M10.5 A G 17: 37,085,891 (GRCm39) I308V probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Jcad T C 18: 4,675,952 (GRCm39) M1238T probably damaging Het
Kank1 T C 19: 25,387,821 (GRCm39) L498S probably damaging Het
Krt10 G A 11: 99,277,933 (GRCm39) T338I possibly damaging Het
Krt13 A T 11: 100,010,877 (GRCm39) L159Q probably benign Het
Lama1 A T 17: 68,057,548 (GRCm39) M541L probably benign Het
Lilra6 A G 7: 3,917,857 (GRCm39) Y96H probably damaging Het
Ltc4s A G 11: 50,128,166 (GRCm39) probably null Het
Ly6g6e G A 17: 35,297,122 (GRCm39) R121Q probably benign Het
Mfn1 A G 3: 32,623,664 (GRCm39) I263V probably benign Het
Mmaa T A 8: 80,008,061 (GRCm39) R59W probably damaging Het
Mug2 C A 6: 122,060,419 (GRCm39) T1385K probably damaging Het
Mypn G T 10: 63,028,648 (GRCm39) Y138* probably null Het
Nav3 A C 10: 109,699,674 (GRCm39) S273R probably damaging Het
Ndufaf1 T C 2: 119,486,218 (GRCm39) E298G probably damaging Het
Or10d5 A G 9: 39,861,824 (GRCm39) L81P possibly damaging Het
Or4c114 T C 2: 88,905,336 (GRCm39) Y33C possibly damaging Het
Or4k42 T C 2: 111,319,602 (GRCm39) probably null Het
Or5k15 T C 16: 58,710,328 (GRCm39) E85G probably benign Het
Or5p51 T C 7: 107,444,025 (GRCm39) K305R probably benign Het
Pak1 A T 7: 97,503,686 (GRCm39) D7V probably benign Het
Pax3 A T 1: 78,173,501 (GRCm39) probably null Het
Plekhg1 G A 10: 3,908,048 (GRCm39) M988I probably benign Het
Prickle1 A G 15: 93,401,518 (GRCm39) F322S probably damaging Het
Prl8a2 A G 13: 27,532,896 (GRCm39) E36G possibly damaging Het
Prss45 A G 9: 110,668,160 (GRCm39) I118V possibly damaging Het
Psd4 T G 2: 24,291,253 (GRCm39) V597G probably damaging Het
Pttg1ip2 T C 5: 5,505,912 (GRCm39) Y123C probably benign Het
Shank3 A T 15: 89,405,413 (GRCm39) K455* probably null Het
Spag17 T A 3: 99,934,935 (GRCm39) W714R probably benign Het
Synrg A G 11: 83,900,050 (GRCm39) E674G probably damaging Het
Tep1 T A 14: 51,071,480 (GRCm39) H2055L probably benign Het
Terb1 T C 8: 105,225,227 (GRCm39) T14A probably damaging Het
Tmub2 T A 11: 102,178,581 (GRCm39) D161E probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Tyr T A 7: 87,078,397 (GRCm39) I488F probably benign Het
Uba6 A G 5: 86,280,475 (GRCm39) probably null Het
Unc13c T C 9: 73,838,829 (GRCm39) Y674C probably damaging Het
Vmn2r105 T A 17: 20,448,097 (GRCm39) R242S probably benign Het
Vmn2r12 A G 5: 109,234,398 (GRCm39) Y605H probably benign Het
Wnk1 A G 6: 119,913,328 (GRCm39) probably null Het
Zfhx4 C A 3: 5,455,465 (GRCm39) A1153E probably benign Het
Zfp13 A C 17: 23,795,186 (GRCm39) Y462D probably damaging Het
Zfp644 A G 5: 106,785,110 (GRCm39) M479T possibly damaging Het
Other mutations in Psmb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Psmb10 APN 8 106,664,343 (GRCm39) missense probably damaging 1.00
IGL02421:Psmb10 APN 8 106,664,124 (GRCm39) critical splice donor site probably null
IGL03118:Psmb10 APN 8 106,663,532 (GRCm39) missense probably damaging 1.00
R0506:Psmb10 UTSW 8 106,664,177 (GRCm39) missense possibly damaging 0.95
R4496:Psmb10 UTSW 8 106,662,660 (GRCm39) missense probably damaging 0.98
R8421:Psmb10 UTSW 8 106,663,342 (GRCm39) missense probably benign 0.00
R9308:Psmb10 UTSW 8 106,662,662 (GRCm39) missense probably damaging 0.99
R9610:Psmb10 UTSW 8 106,664,144 (GRCm39) missense probably benign 0.14
R9611:Psmb10 UTSW 8 106,664,144 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GGAACTCAGCTTGGTCTGTC -3'
(R):5'- AAAATCTAGTCAGTATGCCCCG -3'

Sequencing Primer
(F):5'- GAACTCAGCTTGGTCTGTCTTCTTC -3'
(R):5'- TCAGTATGCCCCGGACCAG -3'
Posted On 2014-11-12