Incidental Mutation 'R2420:Chst9'
ID249251
Institutional Source Beutler Lab
Gene Symbol Chst9
Ensembl Gene ENSMUSG00000047161
Gene Namecarbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Synonyms5430438D01Rik, GalNAc4ST-2
MMRRC Submission 040382-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R2420 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location15451924-15760157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15452284 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 407 (N407K)
Ref Sequence ENSEMBL: ENSMUSP00000049975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053017] [ENSMUST00000130553]
Predicted Effect probably damaging
Transcript: ENSMUST00000053017
AA Change: N407K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049975
Gene: ENSMUSG00000047161
AA Change: N407K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
Pfam:Sulfotransfer_2 174 409 1.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130553
SMART Domains Protein: ENSMUSP00000121484
Gene: ENSMUSG00000047161

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of non-reducing N-acetylgalactosamine (GalNAc) residues in both N-glycans and O-glycans. Sulfate groups on carbohydrates confer highly specific functions to glycoproteins, glycolipids, and proteoglycans, and are critical for cell-cell interaction, signal transduction, and embryonic development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
6820408C15Rik A G 2: 152,429,001 K48R probably damaging Het
Acsm2 T C 7: 119,563,634 F44L probably damaging Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Ahnak C T 19: 9,009,256 P2635S possibly damaging Het
Ankrd17 A T 5: 90,289,320 D555E possibly damaging Het
Arhgap29 A G 3: 121,973,980 I24V probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Cwf19l2 A G 9: 3,411,341 K73E possibly damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Egln1 T C 8: 124,948,246 N270S probably benign Het
Eme1 A G 11: 94,645,814 probably null Het
Emilin2 A G 17: 71,274,279 I484T possibly damaging Het
Entpd2 T C 2: 25,399,283 I259T probably benign Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Fga A T 3: 83,033,154 N705I possibly damaging Het
Gas1 G T 13: 60,176,930 probably benign Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm44501 A T 17: 40,578,709 H38L possibly damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jcad T C 18: 4,675,952 M1238T probably damaging Het
Kank1 T C 19: 25,410,457 L498S probably damaging Het
Krt10 G A 11: 99,387,107 T338I possibly damaging Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lilra6 A G 7: 3,914,858 Y96H probably damaging Het
Ltc4s A G 11: 50,237,339 probably null Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mfn1 A G 3: 32,569,515 I263V probably benign Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Mug2 C A 6: 122,083,460 T1385K probably damaging Het
Mypn G T 10: 63,192,869 Y138* probably null Het
Nav3 A C 10: 109,863,813 S273R probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr1290 T C 2: 111,489,257 probably null Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr470 T C 7: 107,844,818 K305R probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pak1 A T 7: 97,854,479 D7V probably benign Het
Pax3 A T 1: 78,196,864 probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Prickle1 A G 15: 93,503,637 F322S probably damaging Het
Prl8a2 A G 13: 27,348,913 E36G possibly damaging Het
Prss45 A G 9: 110,839,092 I118V possibly damaging Het
Psd4 T G 2: 24,401,241 V597G probably damaging Het
Psmb10 A G 8: 105,937,302 S108P probably benign Het
Shank3 A T 15: 89,521,210 K455* probably null Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Tep1 T A 14: 50,834,023 H2055L probably benign Het
Terb1 T C 8: 104,498,595 T14A probably damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyr T A 7: 87,429,189 I488F probably benign Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wnk1 A G 6: 119,936,367 probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp13 A C 17: 23,576,212 Y462D probably damaging Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Other mutations in Chst9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Chst9 APN 18 15453030 missense probably benign 0.34
IGL01910:Chst9 APN 18 15452874 missense possibly damaging 0.90
IGL03038:Chst9 APN 18 15495303 missense probably benign
IGL03146:Chst9 APN 18 15452978 missense probably damaging 1.00
PIT4802001:Chst9 UTSW 18 15452792 missense probably benign 0.01
R0536:Chst9 UTSW 18 15495330 splice site probably benign
R0647:Chst9 UTSW 18 15452669 missense probably damaging 1.00
R1240:Chst9 UTSW 18 15453174 missense probably benign
R1580:Chst9 UTSW 18 15453065 missense probably benign 0.02
R1892:Chst9 UTSW 18 15452960 missense probably damaging 1.00
R2446:Chst9 UTSW 18 15452838 missense possibly damaging 0.90
R4737:Chst9 UTSW 18 15452777 missense probably damaging 1.00
R4790:Chst9 UTSW 18 15453050 missense probably damaging 1.00
R4956:Chst9 UTSW 18 15717988 missense probably damaging 1.00
R5202:Chst9 UTSW 18 15453239 missense probably benign 0.02
R5402:Chst9 UTSW 18 15452815 missense probably damaging 0.98
R5754:Chst9 UTSW 18 15453197 missense possibly damaging 0.77
R6035:Chst9 UTSW 18 15452853 missense probably benign 0.13
R6035:Chst9 UTSW 18 15452853 missense probably benign 0.13
R7225:Chst9 UTSW 18 15452661 missense probably damaging 0.99
R7801:Chst9 UTSW 18 15452277 missense probably benign 0.00
R7896:Chst9 UTSW 18 15452789 missense probably damaging 1.00
R8159:Chst9 UTSW 18 15452308 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGTTGTTTACATGTCTCCTTGAG -3'
(R):5'- TTCTACAGTTGATTGGTGCTCC -3'

Sequencing Primer
(F):5'- AACTTTGTTCCAATTGCTGTCATAC -3'
(R):5'- GGTGCTCCAAAAGAGTTGACATTTCC -3'
Posted On2014-11-12