Incidental Mutation 'R2430:Pdss1'
ID250362
Institutional Source Beutler Lab
Gene Symbol Pdss1
Ensembl Gene ENSMUSG00000026784
Gene Nameprenyl (solanesyl) diphosphate synthase, subunit 1
Synonyms2610203G20Rik, Tprt, mSPS1, 2700031G06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2430 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location22895522-22940266 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 22929593 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 289 (Y289*)
Ref Sequence ENSEMBL: ENSMUSP00000055689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053729]
Predicted Effect probably null
Transcript: ENSMUST00000053729
AA Change: Y289*
SMART Domains Protein: ENSMUSP00000055689
Gene: ENSMUSG00000026784
AA Change: Y289*

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:polyprenyl_synt 117 366 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139472
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that elongates the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. The protein may be peripherally associated with the inner mitochondrial membrane, though no transit peptide has been definitively identified to date. Defects in this gene are a cause of coenzyme Q10 deficiency. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc T C 15: 74,671,891 E161G probably benign Het
Ass1 A G 2: 31,501,496 H261R probably damaging Het
Car11 T A 7: 45,703,648 probably null Het
Crebbp T C 16: 4,096,465 H844R probably damaging Het
Dnaic2 A G 11: 114,757,186 probably benign Het
Eya2 T C 2: 165,716,130 probably null Het
Klhl40 A G 9: 121,780,601 D484G possibly damaging Het
Knstrn A G 2: 118,834,103 probably benign Het
Nckap5 A G 1: 125,914,757 S1838P probably damaging Het
Nipsnap2 A G 5: 129,744,791 D117G possibly damaging Het
Nudt15 C T 14: 73,525,302 probably benign Het
Olfr1082 A G 2: 86,594,708 I40T probably benign Het
Olfr1140 T A 2: 87,746,655 M153K possibly damaging Het
Pcdh20 T C 14: 88,467,548 D772G probably damaging Het
Phc2 A T 4: 128,707,983 Y77F probably damaging Het
Ppip5k2 A T 1: 97,735,030 Y667N probably damaging Het
Prdm2 A G 4: 143,133,163 S1186P possibly damaging Het
Prr36 A T 8: 4,213,488 probably benign Het
Reck C T 4: 43,930,202 T592I possibly damaging Het
Rprd2 T A 3: 95,764,795 K1015* probably null Het
Tfrc T G 16: 32,626,711 Y617D probably damaging Het
Tnfsf11 A C 14: 78,284,312 D152E probably benign Het
Vmn2r54 T A 7: 12,632,006 I334F probably damaging Het
Other mutations in Pdss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Pdss1 APN 2 22935577 missense possibly damaging 0.49
IGL02512:Pdss1 APN 2 22912646 missense probably damaging 1.00
IGL02691:Pdss1 APN 2 22915241 missense probably benign
LCD18:Pdss1 UTSW 2 22900968 intron probably benign
R0190:Pdss1 UTSW 2 22906831 missense probably damaging 0.97
R0576:Pdss1 UTSW 2 22915413 critical splice acceptor site probably null
R0732:Pdss1 UTSW 2 22901312 missense probably benign 0.00
R1682:Pdss1 UTSW 2 22915519 missense probably damaging 1.00
R1808:Pdss1 UTSW 2 22906834 nonsense probably null
R2937:Pdss1 UTSW 2 22906787 splice site probably null
R2938:Pdss1 UTSW 2 22906787 splice site probably null
R4181:Pdss1 UTSW 2 22915505 missense probably damaging 1.00
R4302:Pdss1 UTSW 2 22915505 missense probably damaging 1.00
R4323:Pdss1 UTSW 2 22912596 splice site probably benign
R5076:Pdss1 UTSW 2 22899917 critical splice acceptor site probably null
R5108:Pdss1 UTSW 2 22906883 missense possibly damaging 0.94
R6333:Pdss1 UTSW 2 22901766 missense probably damaging 1.00
R7138:Pdss1 UTSW 2 22912669 missense probably damaging 1.00
R7286:Pdss1 UTSW 2 22935641 critical splice donor site probably null
R8169:Pdss1 UTSW 2 22901812 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGTGCCAGCATCCCCATTG -3'
(R):5'- GCTATGCCTAGCTTCAGGTC -3'

Sequencing Primer
(F):5'- AGCATCCCCATTGTCTATAGCATAGG -3'
(R):5'- TTGCCCATCTGGTCAGAACATGAG -3'
Posted On2014-11-12