Incidental Mutation 'R2847:Fbf1'
ID251749
Institutional Source Beutler Lab
Gene Symbol Fbf1
Ensembl Gene ENSMUSG00000020776
Gene NameFas (TNFRSF6) binding factor 1
Synonyms1110033G01Rik
MMRRC Submission 040440-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2847 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116142285-116168166 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 116157688 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103031] [ENSMUST00000103031] [ENSMUST00000103031] [ENSMUST00000103031] [ENSMUST00000106435] [ENSMUST00000106435] [ENSMUST00000106435] [ENSMUST00000106435] [ENSMUST00000124828] [ENSMUST00000124828] [ENSMUST00000124828]
Predicted Effect probably null
Transcript: ENSMUST00000103031
SMART Domains Protein: ENSMUSP00000099320
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103031
SMART Domains Protein: ENSMUSP00000099320
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103031
SMART Domains Protein: ENSMUSP00000099320
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103031
SMART Domains Protein: ENSMUSP00000099320
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106435
SMART Domains Protein: ENSMUSP00000102043
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106435
SMART Domains Protein: ENSMUSP00000102043
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106435
SMART Domains Protein: ENSMUSP00000102043
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106435
SMART Domains Protein: ENSMUSP00000102043
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124828
SMART Domains Protein: ENSMUSP00000114558
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124828
SMART Domains Protein: ENSMUSP00000114558
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000124828
SMART Domains Protein: ENSMUSP00000114558
Gene: ENSMUSG00000020776

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150703
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik T C 9: 53,264,789 noncoding transcript Het
Abca13 T C 11: 9,294,584 V2149A possibly damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adgrf5 C A 17: 43,422,640 N118K possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
Bub3 C T 7: 131,570,884 T326M possibly damaging Het
Cd151 T C 7: 141,469,550 Y57H probably damaging Het
Cib4 T C 5: 30,488,588 N112S probably damaging Het
Cntnap5c A T 17: 57,876,392 D31V probably damaging Het
Cobl A G 11: 12,378,342 L81P probably damaging Het
Cpsf1 A T 15: 76,602,851 L209Q probably damaging Het
Crocc G A 4: 141,018,756 A1684V probably damaging Het
Cyp4f37 T A 17: 32,629,125 C206S probably damaging Het
Defb39 C T 8: 19,052,893 R62H possibly damaging Het
Diexf A T 1: 193,128,451 N81K probably benign Het
Dnah6 T C 6: 73,129,331 K1756E probably benign Het
Efcab12 A G 6: 115,811,111 I630T probably damaging Het
Erc2 T C 14: 28,040,488 V736A probably damaging Het
Fndc9 C T 11: 46,238,041 A129V probably damaging Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Gba2 T C 4: 43,568,000 probably null Het
Gna12 T A 5: 140,785,593 D61V probably damaging Het
Gpr37 C T 6: 25,666,946 probably benign Het
Grin2a A G 16: 9,761,965 F145L possibly damaging Het
Grin2b C A 6: 135,740,953 V714L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Htr4 T C 18: 62,428,126 S153P probably damaging Het
Igkv9-120 T A 6: 68,050,144 probably benign Het
Itgb6 T C 2: 60,600,535 T772A probably damaging Het
Mgam C A 6: 40,652,715 A86E possibly damaging Het
Mme T A 3: 63,345,199 N421K possibly damaging Het
Mmp1b C T 9: 7,370,763 V331I probably benign Het
Naa16 A G 14: 79,335,883 C816R probably damaging Het
Nav1 G C 1: 135,450,644 probably null Het
Nln A G 13: 104,025,025 M679T probably damaging Het
Olfr353 A G 2: 36,890,524 L108P probably damaging Het
Olfr920 C T 9: 38,756,036 T116I possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pax7 T C 4: 139,779,643 D361G possibly damaging Het
Peg10 C T 6: 4,756,912 probably benign Het
Plekhh2 G T 17: 84,597,966 R1096L probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Robo4 C T 9: 37,404,476 R342* probably null Het
Sec23ip G A 7: 128,754,073 V307I probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
St5 T C 7: 109,525,337 Q1099R probably damaging Het
Tas1r3 T A 4: 155,860,202 Q854L probably benign Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trpm4 A G 7: 45,310,598 F771S probably damaging Het
Tstd3 A T 4: 21,759,375 F132L possibly damaging Het
Ulk2 T C 11: 61,824,729 probably null Het
Unc13b T C 4: 43,180,404 Y3080H probably benign Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn2r114 A T 17: 23,290,974 M844K probably benign Het
Vmn2r60 A T 7: 42,136,433 H220L probably benign Het
Vps13a A G 19: 16,703,599 S1078P probably damaging Het
Vwa8 G T 14: 78,947,142 R360L probably benign Het
Xlr4b A T X: 73,215,332 Q25L probably null Het
Zdhhc22 T A 12: 86,988,562 T39S probably benign Het
Zfp532 T A 18: 65,656,626 H1045Q possibly damaging Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zfp985 G A 4: 147,583,011 W112* probably null Het
Other mutations in Fbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Fbf1 APN 11 116151081 missense probably benign 0.00
IGL01420:Fbf1 APN 11 116145996 missense probably benign 0.07
IGL01971:Fbf1 APN 11 116143382 unclassified probably benign
IGL01995:Fbf1 APN 11 116151020 missense probably null 0.00
IGL02639:Fbf1 APN 11 116152600 missense probably benign 0.14
IGL02884:Fbf1 APN 11 116146513 missense probably damaging 1.00
IGL03001:Fbf1 APN 11 116165886 start gained probably benign
IGL03309:Fbf1 APN 11 116147811 missense probably damaging 1.00
R0098:Fbf1 UTSW 11 116148119 critical splice donor site probably null
R0098:Fbf1 UTSW 11 116148119 critical splice donor site probably null
R0234:Fbf1 UTSW 11 116155034 missense probably damaging 1.00
R0234:Fbf1 UTSW 11 116155034 missense probably damaging 1.00
R0257:Fbf1 UTSW 11 116155091 missense probably benign 0.05
R0394:Fbf1 UTSW 11 116152462 unclassified probably benign
R0637:Fbf1 UTSW 11 116160054 unclassified probably benign
R1512:Fbf1 UTSW 11 116147927 missense probably damaging 1.00
R1679:Fbf1 UTSW 11 116151017 critical splice donor site probably null
R1726:Fbf1 UTSW 11 116145454 missense probably benign
R1909:Fbf1 UTSW 11 116145992 missense possibly damaging 0.79
R1970:Fbf1 UTSW 11 116151491 missense possibly damaging 0.93
R2507:Fbf1 UTSW 11 116155426 missense probably benign
R2849:Fbf1 UTSW 11 116157688 critical splice donor site probably null
R2867:Fbf1 UTSW 11 116161448 unclassified probably benign
R3161:Fbf1 UTSW 11 116148220 missense probably damaging 1.00
R3711:Fbf1 UTSW 11 116161473 missense possibly damaging 0.66
R3711:Fbf1 UTSW 11 116163353 missense probably damaging 1.00
R3752:Fbf1 UTSW 11 116147796 missense probably benign 0.21
R4293:Fbf1 UTSW 11 116148894 missense probably damaging 1.00
R4344:Fbf1 UTSW 11 116147742 missense probably benign
R4345:Fbf1 UTSW 11 116147742 missense probably benign
R4604:Fbf1 UTSW 11 116158922 missense possibly damaging 0.81
R4828:Fbf1 UTSW 11 116148951 missense probably benign 0.00
R4936:Fbf1 UTSW 11 116152552 missense probably benign 0.05
R5561:Fbf1 UTSW 11 116157820 missense probably damaging 1.00
R6392:Fbf1 UTSW 11 116152949 critical splice acceptor site probably null
R6559:Fbf1 UTSW 11 116155446 missense probably benign 0.15
R6993:Fbf1 UTSW 11 116152784 missense probably benign
R7207:Fbf1 UTSW 11 116149474 missense probably benign 0.01
R7544:Fbf1 UTSW 11 116165833 missense probably benign 0.01
R7988:Fbf1 UTSW 11 116152768 missense probably benign 0.00
R8230:Fbf1 UTSW 11 116146739 missense probably benign
R8262:Fbf1 UTSW 11 116154019 missense probably benign 0.19
R8508:Fbf1 UTSW 11 116165881 start codon destroyed probably null 0.00
X0020:Fbf1 UTSW 11 116150793 missense possibly damaging 0.78
X0060:Fbf1 UTSW 11 116148856 nonsense probably null
X0062:Fbf1 UTSW 11 116149426 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTTTGATCCTCCATCCTAGGC -3'
(R):5'- TTAGGGACTTCAACCACACAG -3'

Sequencing Primer
(F):5'- TCCTGCCACGATGATAATGG -3'
(R):5'- CACCCTCCCAGACACCGG -3'
Posted On2014-12-04