Incidental Mutation 'R2937:Cela3b'
ID255049
Institutional Source Beutler Lab
Gene Symbol Cela3b
Ensembl Gene ENSMUSG00000023433
Gene Namechymotrypsin-like elastase family, member 3B
Synonyms2310074F01Rik, Ela3b, Ela3, 0910001F22Rik
MMRRC Submission 040514-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2937 (G1)
Quality Score222
Status Validated
Chromosome4
Chromosomal Location137420999-137430540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137423263 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 208 (I208T)
Ref Sequence ENSEMBL: ENSMUSP00000099581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102522]
Predicted Effect probably benign
Transcript: ENSMUST00000102522
AA Change: I208T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099581
Gene: ENSMUSG00000023433
AA Change: I208T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 27 262 8.81e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134565
Meta Mutation Damage Score 0.0681 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, elastase 3B has little elastolytic activity. Like most of the human elastases, elastase 3B is secreted from the pancreas as a zymogen and, like other serine proteases such as trypsin, chymotrypsin and kallikrein, it has a digestive function in the intestine. Elastase 3B preferentially cleaves proteins after alanine residues. Elastase 3B may also function in the intestinal transport and metabolism of cholesterol. Both elastase 3A and elastase 3B have been referred to as protease E and as elastase 1, and excretion of this protein in fecal material is frequently used as a measure of pancreatic function in clinical assays. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,659,127 E481G probably damaging Het
Anks1b C T 10: 90,077,066 T351M probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Asph A C 4: 9,542,314 probably benign Het
Bace2 T C 16: 97,412,188 probably null Het
BC051142 A T 17: 34,421,862 H57L possibly damaging Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Clca3a2 T A 3: 144,813,918 T232S probably benign Het
Col1a2 G A 6: 4,519,882 probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Cpd T C 11: 76,811,859 N561S probably damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dnah10 T C 5: 124,819,412 probably null Het
Dsg2 T C 18: 20,579,128 F107S probably damaging Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fermt2 A C 14: 45,504,491 probably null Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Grtp1 G A 8: 13,189,755 probably benign Het
Hecw1 G T 13: 14,245,836 Q1001K possibly damaging Het
Hydin T C 8: 110,404,295 V606A possibly damaging Het
Krt33b T A 11: 100,024,009 N388I probably benign Het
Lipf T C 19: 33,973,038 Y277H probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Maats1 A T 16: 38,311,038 I471N possibly damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Med17 T C 9: 15,275,891 K196E probably damaging Het
Mmp25 T A 17: 23,644,791 I22F probably benign Het
Nrg3 T A 14: 38,371,008 N540I possibly damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr584 T A 7: 103,086,341 H269Q probably benign Het
Olfr600 T C 7: 103,346,065 M288V probably benign Het
Pcdh1 G T 18: 38,189,762 A1006E probably benign Het
Pdss1 T A 2: 22,906,787 probably null Het
Plaa G A 4: 94,569,459 A758V probably damaging Het
Prl6a1 T A 13: 27,315,320 W24R probably damaging Het
Ptk7 T C 17: 46,572,550 H863R probably damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Rhou T C 8: 123,661,141 I204T possibly damaging Het
Serpind1 G T 16: 17,337,108 M266I probably benign Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Slc2a2 T G 3: 28,718,771 C238G probably damaging Het
Slc39a8 A G 3: 135,886,823 M420V probably benign Het
Slc7a9 C A 7: 35,463,742 Y457* probably null Het
Smpd3 C T 8: 106,264,820 R367H probably damaging Het
Sntb2 T C 8: 106,936,097 V99A probably benign Het
Specc1l T G 10: 75,259,131 I796R probably damaging Het
Stfa2l1 G T 16: 36,159,946 V29F probably damaging Het
Synrg T C 11: 83,994,354 F455S probably damaging Het
Tap2 T C 17: 34,212,354 V422A possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tcp10a A G 17: 7,329,774 Y110C probably damaging Het
Thoc1 T A 18: 9,959,255 S43R probably damaging Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Trpc3 G A 3: 36,634,383 R836* probably null Het
Ube2u T C 4: 100,524,298 S185P possibly damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vcp A G 4: 42,980,846 Y755H probably damaging Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdfy3 A T 5: 101,944,122 F450L probably benign Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Xylt1 C A 7: 117,634,784 Q513K probably benign Het
Zfp229 T C 17: 21,745,503 F238S probably damaging Het
Other mutations in Cela3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Cela3b APN 4 137423281 missense probably damaging 1.00
IGL00708:Cela3b APN 4 137421969 missense probably benign
IGL01301:Cela3b APN 4 137423843 critical splice donor site probably null
IGL01613:Cela3b APN 4 137425071 missense possibly damaging 0.66
ANU18:Cela3b UTSW 4 137423843 critical splice donor site probably null
R0669:Cela3b UTSW 4 137428530 missense probably benign 0.06
R2938:Cela3b UTSW 4 137423263 missense probably benign 0.01
R4327:Cela3b UTSW 4 137423931 missense probably benign 0.26
R4451:Cela3b UTSW 4 137421044 utr 3 prime probably benign
R5059:Cela3b UTSW 4 137424870 missense probably benign 0.00
R5707:Cela3b UTSW 4 137424856 missense probably damaging 1.00
R7952:Cela3b UTSW 4 137421908 missense probably benign 0.27
X0019:Cela3b UTSW 4 137423310 missense probably damaging 1.00
X0019:Cela3b UTSW 4 137423311 missense probably damaging 1.00
Z1177:Cela3b UTSW 4 137428484 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGGATACAACCCAGGCTCCTG -3'
(R):5'- TGTGCCCAATGCTCCAGAAC -3'

Sequencing Primer
(F):5'- AGGCTCCTGATACTACCTCTGAG -3'
(R):5'- ATGGAGCCTGAAGGTTTCCACTC -3'
Posted On2014-12-29