Incidental Mutation 'R2921:Ralgps1'
ID255505
Institutional Source Beutler Lab
Gene Symbol Ralgps1
Ensembl Gene ENSMUSG00000038831
Gene NameRal GEF with PH domain and SH3 binding motif 1
SynonymsRALGPS1A, 5830418G11Rik, RALGEF2
MMRRC Submission 040506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R2921 (G1)
Quality Score223
Status Not validated
Chromosome2
Chromosomal Location33133417-33371486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33143070 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 449 (I449N)
Ref Sequence ENSEMBL: ENSMUSP00000048451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298]
PDB Structure
Crystal structure of MS0666 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000042615
AA Change: I449N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831
AA Change: I449N

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000091039
AA Change: I537N

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831
AA Change: I537N

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113165
AA Change: I509N

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831
AA Change: I509N

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131298
AA Change: I467N

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831
AA Change: I467N

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138704
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Adipor1 T C 1: 134,425,993 V172A possibly damaging Het
Akt2 A G 7: 27,628,986 K146R probably benign Het
Atg4a T C X: 141,158,772 V284A possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Ccdc144b T C 3: 36,025,928 M227V probably null Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dpm3 C T 3: 89,266,755 L8F probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Fndc1 A G 17: 7,804,875 S83P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mlkl T C 8: 111,316,447 E356G probably benign Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Nr1h4 A T 10: 89,498,361 Y42N probably damaging Het
Nup155 A C 15: 8,153,641 E1228D probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Pde4dip T C 3: 97,719,569 N1218D probably benign Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rfx7 G A 9: 72,617,664 G712D possibly damaging Het
Rnf151 C T 17: 24,716,261 G232D possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Safb2 A G 17: 56,568,906 V89A possibly damaging Het
Setx TGTGG TG 2: 29,154,060 probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Slc26a2 T A 18: 61,201,935 I149F probably damaging Het
Slc6a15 A G 10: 103,418,387 D728G probably damaging Het
Slfn3 A G 11: 83,215,045 M623V probably benign Het
Smim1 A G 4: 154,023,640 probably benign Het
Spatc1 T C 15: 76,283,925 S195P probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Trpc6 A T 9: 8,653,033 L613F possibly damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Ralgps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Ralgps1 APN 2 33137682 makesense probably null
IGL00780:Ralgps1 APN 2 33273627 missense probably damaging 1.00
IGL00951:Ralgps1 APN 2 33273602 missense probably damaging 1.00
IGL01358:Ralgps1 APN 2 33143049 missense possibly damaging 0.62
IGL02346:Ralgps1 APN 2 33157770 critical splice donor site probably null
IGL02481:Ralgps1 APN 2 33340729 missense probably benign 0.04
IGL03281:Ralgps1 APN 2 33172416 critical splice donor site probably null
IGL03284:Ralgps1 APN 2 33146565 splice site probably benign
IGL03377:Ralgps1 APN 2 33172461 missense probably damaging 1.00
R0007:Ralgps1 UTSW 2 33143389 missense probably damaging 0.97
R0029:Ralgps1 UTSW 2 33141019 missense probably benign
R0309:Ralgps1 UTSW 2 33157923 missense probably benign
R0320:Ralgps1 UTSW 2 33141015 missense possibly damaging 0.59
R0622:Ralgps1 UTSW 2 33174447 nonsense probably null
R1277:Ralgps1 UTSW 2 33174425 missense possibly damaging 0.51
R1797:Ralgps1 UTSW 2 33340711 critical splice donor site probably null
R3123:Ralgps1 UTSW 2 33158956 missense possibly damaging 0.81
R3124:Ralgps1 UTSW 2 33158956 missense possibly damaging 0.81
R4741:Ralgps1 UTSW 2 33336587 missense probably benign 0.00
R4894:Ralgps1 UTSW 2 33143103 missense possibly damaging 0.71
R5148:Ralgps1 UTSW 2 33158987 missense probably damaging 1.00
R5255:Ralgps1 UTSW 2 33276159 missense probably damaging 1.00
R5877:Ralgps1 UTSW 2 33243628 unclassified probably benign
R6330:Ralgps1 UTSW 2 33174443 missense probably damaging 1.00
R6908:Ralgps1 UTSW 2 33143100 missense probably benign 0.17
R7252:Ralgps1 UTSW 2 33168188 missense probably benign 0.12
R7299:Ralgps1 UTSW 2 33157873 missense probably benign
R7366:Ralgps1 UTSW 2 33324688 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CATCAAGTCAAAGGCAAGGC -3'
(R):5'- AAGTCCTCTGAAAAGGCTGCC -3'

Sequencing Primer
(F):5'- GCAAGGCCTCTCTCACTG -3'
(R):5'- TCTGAAAAGGCTGCCTGTGC -3'
Posted On2014-12-29