Incidental Mutation 'R3014:Gprin1'
ID257611
Institutional Source Beutler Lab
Gene Symbol Gprin1
Ensembl Gene ENSMUSG00000069227
Gene NameG protein-regulated inducer of neurite outgrowth 1
SynonymsGRIN1, Z16
MMRRC Submission 040535-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3014 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location54736671-54749874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54738475 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 662 (D662V)
Ref Sequence ENSEMBL: ENSMUSP00000115539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037145] [ENSMUST00000099506] [ENSMUST00000135343]
Predicted Effect probably benign
Transcript: ENSMUST00000037145
SMART Domains Protein: ENSMUSP00000043596
Gene: ENSMUSG00000034918

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 48 122 8.62e-15 SMART
CA 146 239 1.4e-2 SMART
CA 263 351 2.19e-16 SMART
CA 391 478 4.22e-9 SMART
CA 503 584 2.15e-24 SMART
CA 605 693 6.78e-22 SMART
CA 715 805 1.78e-16 SMART
CA 830 925 7.57e-11 SMART
CA 950 1042 7.1e-2 SMART
low complexity region 1121 1147 N/A INTRINSIC
transmembrane domain 1153 1175 N/A INTRINSIC
low complexity region 1195 1209 N/A INTRINSIC
low complexity region 1234 1250 N/A INTRINSIC
low complexity region 1264 1277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099506
AA Change: D662V

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097106
Gene: ENSMUSG00000069227
AA Change: D662V

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
internal_repeat_1 80 256 2.14e-7 PROSPERO
internal_repeat_2 95 267 4.89e-7 PROSPERO
low complexity region 314 324 N/A INTRINSIC
low complexity region 424 443 N/A INTRINSIC
internal_repeat_2 448 620 4.89e-7 PROSPERO
internal_repeat_1 457 643 2.14e-7 PROSPERO
low complexity region 684 703 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
Pfam:GRIN_C 790 929 4.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135343
AA Change: D662V

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115539
Gene: ENSMUSG00000069227
AA Change: D662V

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
internal_repeat_1 80 256 2.14e-7 PROSPERO
internal_repeat_2 95 267 4.89e-7 PROSPERO
low complexity region 314 324 N/A INTRINSIC
low complexity region 424 443 N/A INTRINSIC
internal_repeat_2 448 620 4.89e-7 PROSPERO
internal_repeat_1 457 643 2.14e-7 PROSPERO
low complexity region 684 703 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
Pfam:GRIN_C 787 932 2.6e-49 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angpt4 G T 2: 151,929,597 V278L probably benign Het
BC049730 A G 7: 24,713,396 I76M possibly damaging Het
Dmbt1 A G 7: 131,032,097 probably benign Het
Dnah2 A T 11: 69,430,478 N3921K probably benign Het
Fam193a A T 5: 34,465,672 E1201D probably benign Het
Gm10220 G C 5: 26,117,828 D195E probably damaging Het
Gm4981 G A 10: 58,235,534 T286I possibly damaging Het
Gmps A G 3: 64,015,436 K607E possibly damaging Het
Gria4 A G 9: 4,464,294 I556T probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hcar2 A T 5: 123,864,705 V245E probably damaging Het
Hmces T G 6: 87,917,841 D62E probably benign Het
Ighv1-4 T A 12: 114,487,149 Y113F possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kng1 C T 16: 23,079,370 H507Y possibly damaging Het
Map3k5 A T 10: 20,094,429 Y694F probably damaging Het
Myo1a T G 10: 127,716,345 F778V probably damaging Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Olfr1347 A T 7: 6,488,471 Y134* probably null Het
Olfr1377 A G 11: 50,984,707 D2G probably benign Het
Olfr303 A G 7: 86,394,676 V274A probably benign Het
Olfr723 G A 14: 49,929,032 H171Y probably benign Het
Parp3 C A 9: 106,471,315 S507I possibly damaging Het
Ppip5k2 T A 1: 97,744,075 T491S probably damaging Het
Psmg1 T A 16: 95,980,048 I266F probably damaging Het
Ptpn23 T C 9: 110,389,695 T476A probably benign Het
Rttn G C 18: 89,014,620 V671L probably damaging Het
Srsf7 T C 17: 80,201,561 E235G unknown Het
Sv2a G A 3: 96,189,435 W416* probably null Het
Tas2r107 A G 6: 131,660,009 Y26H probably benign Het
Tenm2 T C 11: 36,023,973 T2245A probably damaging Het
Vmn2r13 T A 5: 109,171,761 H451L possibly damaging Het
Xkr6 T C 14: 63,819,344 Y235H unknown Het
Other mutations in Gprin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Gprin1 APN 13 54740369 missense probably damaging 1.00
IGL02001:Gprin1 APN 13 54739192 missense probably damaging 1.00
IGL03188:Gprin1 APN 13 54738652 missense probably benign 0.02
IGL03308:Gprin1 APN 13 54740144 missense probably benign 0.05
R0980:Gprin1 UTSW 13 54740401 missense possibly damaging 0.75
R1638:Gprin1 UTSW 13 54739876 missense possibly damaging 0.53
R1942:Gprin1 UTSW 13 54739939 missense probably benign 0.36
R2145:Gprin1 UTSW 13 54738632 missense probably damaging 0.99
R2215:Gprin1 UTSW 13 54740233 missense probably damaging 0.99
R2338:Gprin1 UTSW 13 54738425 unclassified probably null
R4634:Gprin1 UTSW 13 54738058 missense probably damaging 1.00
R4732:Gprin1 UTSW 13 54739957 missense possibly damaging 0.50
R4733:Gprin1 UTSW 13 54739957 missense possibly damaging 0.50
R4903:Gprin1 UTSW 13 54737929 missense probably damaging 1.00
R4915:Gprin1 UTSW 13 54738073 missense probably damaging 1.00
R5102:Gprin1 UTSW 13 54739763 missense probably benign 0.06
R5979:Gprin1 UTSW 13 54739978 missense probably benign 0.01
R6544:Gprin1 UTSW 13 54740311 missense possibly damaging 0.46
R7007:Gprin1 UTSW 13 54738256 missense probably damaging 1.00
R7022:Gprin1 UTSW 13 54739042 missense probably benign 0.11
R7110:Gprin1 UTSW 13 54739243 missense probably benign 0.01
R7385:Gprin1 UTSW 13 54738610 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTACACTTCCCACGTCATGC -3'
(R):5'- TGAGAAGACAGATCCCTCCAG -3'

Sequencing Primer
(F):5'- TCCTGCGGAGACATGGG -3'
(R):5'- GACAGATCCCTCCAGAAAAGTCG -3'
Posted On2015-01-11