Incidental Mutation 'R3721:Il18rap'
ID258883
Institutional Source Beutler Lab
Gene Symbol Il18rap
Ensembl Gene ENSMUSG00000026068
Gene Nameinterleukin 18 receptor accessory protein
SynonymsAcPL accessory protein-like)
MMRRC Submission 040712-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3721 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location40515362-40551705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40537088 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 253 (L253Q)
Ref Sequence ENSEMBL: ENSMUSP00000027237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027237]
Predicted Effect probably damaging
Transcript: ENSMUST00000027237
AA Change: L253Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027237
Gene: ENSMUSG00000026068
AA Change: L253Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:IG_like 31 144 2e-36 BLAST
IG 159 240 2.94e0 SMART
IG 257 354 1.35e0 SMART
transmembrane domain 363 385 N/A INTRINSIC
TIR 406 561 3.68e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163057
Meta Mutation Damage Score 0.7050 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Interleukin-18 (or interferon-gamma inducing factor) is a proinflammatory cytokine that induces cell-mediated immunity following microbial infection. This gene encodes a member of the interleukin-1 receptor family. The encoded protein is an accessory subunit of the receptor for interleukin-18 and mediates signaling through this cytokine. Mice lacking this gene exhibit a defective cell-mediated immune response. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice exhibit defective IL-18-mediated immune responses such as the inability of splenocytes, T helper 1 cells and neutrophils to produce cytokines in response to IL-18. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a T C 2: 48,892,138 S228P probably damaging Het
Adamts2 C T 11: 50,773,211 probably benign Het
Arhgap9 A G 10: 127,328,971 E588G possibly damaging Het
Ash2l C G 8: 25,818,625 G453A probably damaging Het
Catsperg2 A G 7: 29,705,102 V638A probably benign Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cdc73 T C 1: 143,695,453 I83V possibly damaging Het
Clec2e C A 6: 129,094,410 E155* probably null Het
Cyp3a59 T A 5: 146,096,597 M181K probably damaging Het
Dars2 A T 1: 161,063,308 V111E probably benign Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Emilin2 T C 17: 71,273,454 N759S probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam102b C T 3: 108,979,767 R305Q probably damaging Het
Ggnbp1 T C 17: 27,029,613 V52A probably benign Het
Gm5155 A G 7: 17,902,738 T247A probably benign Het
Gpr171 A G 3: 59,097,670 V228A possibly damaging Het
Gsta3 T C 1: 21,260,089 M55T probably benign Het
Hectd3 T A 4: 116,999,745 N496K probably benign Het
Hp1bp3 T G 4: 138,239,608 F367V probably damaging Het
Irs1 C T 1: 82,290,085 G137S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lair1 A C 7: 4,010,783 L155R probably damaging Het
Larp7 A G 3: 127,546,811 L126P probably damaging Het
Lhx1 G A 11: 84,521,828 R89C probably damaging Het
Lypd4 C A 7: 24,865,459 A85S probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myh10 G T 11: 68,813,052 R1863L probably damaging Het
Myo9a G A 9: 59,868,180 V1025I probably benign Het
Naa25 T A 5: 121,431,556 D659E probably benign Het
Nol9 A G 4: 152,039,706 S118G probably benign Het
Olfr497 G T 7: 108,423,119 D183Y probably damaging Het
Olfr730 C T 14: 50,186,680 C179Y probably damaging Het
Pde10a T A 17: 8,969,589 I907N probably damaging Het
Pkhd1 T C 1: 20,585,655 D218G probably benign Het
Poll A G 19: 45,553,577 I430T probably damaging Het
Pomgnt1 T G 4: 116,153,543 probably benign Het
Rab6b T C 9: 103,167,174 probably null Het
Rad1 T C 15: 10,488,026 S79P probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rcc1 T C 4: 132,337,814 K133E possibly damaging Het
Ric8a T C 7: 140,861,961 probably null Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rps6ka4 A G 19: 6,839,277 V146A possibly damaging Het
Sh3bp4 A G 1: 89,145,328 I633V possibly damaging Het
Slc2a2 T A 3: 28,727,152 N446K probably damaging Het
Slc44a1 T C 4: 53,491,445 Y61H probably damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Smc5 T C 19: 23,210,492 M911V probably benign Het
Sntb1 C A 15: 55,642,818 R453L probably benign Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Srrm2 CTCCTCTTCTTCCTCTTCTTCCTC CTCCTCTTCTTCCTC 17: 23,822,575 probably benign Het
Trpm1 T G 7: 64,217,727 probably benign Het
Tufm T C 7: 126,490,460 M442T probably benign Het
Ubn1 A G 16: 5,073,378 N539S possibly damaging Het
Other mutations in Il18rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Il18rap APN 1 40541921 missense probably benign 0.03
IGL01467:Il18rap APN 1 40548639 missense probably damaging 1.00
IGL01505:Il18rap APN 1 40537084 missense probably damaging 0.97
IGL02215:Il18rap APN 1 40547922 missense probably damaging 1.00
IGL03307:Il18rap APN 1 40543067 missense probably benign 0.01
R0136:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0299:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0358:Il18rap UTSW 1 40549042 missense possibly damaging 0.53
R0499:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0830:Il18rap UTSW 1 40542990 missense probably damaging 1.00
R1386:Il18rap UTSW 1 40531522 missense probably benign 0.00
R1817:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1818:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1819:Il18rap UTSW 1 40531527 missense probably benign 0.04
R5634:Il18rap UTSW 1 40539376 intron probably benign
R5663:Il18rap UTSW 1 40531557 missense probably damaging 1.00
R5690:Il18rap UTSW 1 40537112 missense possibly damaging 0.73
R5825:Il18rap UTSW 1 40531566 missense probably benign 0.38
R6140:Il18rap UTSW 1 40525052 missense probably benign 0.04
R6291:Il18rap UTSW 1 40524889 missense probably benign 0.00
R6859:Il18rap UTSW 1 40525095 nonsense probably null
R6992:Il18rap UTSW 1 40542035 missense probably benign 0.00
R7317:Il18rap UTSW 1 40525376 missense probably damaging 0.98
R7402:Il18rap UTSW 1 40524951 missense probably benign 0.01
R7465:Il18rap UTSW 1 40543089 missense probably damaging 1.00
R7561:Il18rap UTSW 1 40524377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAAGGAGCAGCAGCATCTTC -3'
(R):5'- AACTCATCAGGGCCAAGTG -3'

Sequencing Primer
(F):5'- CCCTGTACTGGGGCATACAAAG -3'
(R):5'- TGAAGGTACACAGCGAATACTCTAGC -3'
Posted On2015-01-23