Incidental Mutation 'R0830:Il18rap'
ID77469
Institutional Source Beutler Lab
Gene Symbol Il18rap
Ensembl Gene ENSMUSG00000026068
Gene Nameinterleukin 18 receptor accessory protein
SynonymsAcPL accessory protein-like)
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0830 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location40515362-40551705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40542990 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 357 (V357E)
Ref Sequence ENSEMBL: ENSMUSP00000027237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027237]
Predicted Effect probably damaging
Transcript: ENSMUST00000027237
AA Change: V357E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027237
Gene: ENSMUSG00000026068
AA Change: V357E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:IG_like 31 144 2e-36 BLAST
IG 159 240 2.94e0 SMART
IG 257 354 1.35e0 SMART
transmembrane domain 363 385 N/A INTRINSIC
TIR 406 561 3.68e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163057
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.0%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: Interleukin-18 (or interferon-gamma inducing factor) is a proinflammatory cytokine that induces cell-mediated immunity following microbial infection. This gene encodes a member of the interleukin-1 receptor family. The encoded protein is an accessory subunit of the receptor for interleukin-18 and mediates signaling through this cytokine. Mice lacking this gene exhibit a defective cell-mediated immune response. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice exhibit defective IL-18-mediated immune responses such as the inability of splenocytes, T helper 1 cells and neutrophils to produce cytokines in response to IL-18. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,427 R145H probably damaging Het
2410089E03Rik T A 15: 8,247,185 V2771E unknown Het
Adam26a C T 8: 43,568,402 V684I probably benign Het
Alk T C 17: 72,603,200 I170M probably benign Het
Apc2 T C 10: 80,315,405 Y2069H probably damaging Het
Aspm A G 1: 139,474,254 T1219A probably damaging Het
Bnip1 T C 17: 26,789,705 S94P probably benign Het
Cftr A G 6: 18,270,225 I805V probably benign Het
Col25a1 T A 3: 130,584,726 D609E probably damaging Het
Cyp2g1 A G 7: 26,814,791 K274R probably benign Het
D5Ertd579e G A 5: 36,613,757 T1098I probably damaging Het
Ddx39 T A 8: 83,719,823 C74S possibly damaging Het
E2f3 C T 13: 29,985,560 A37T probably benign Het
Emilin2 A G 17: 71,273,820 M637T probably benign Het
Exosc7 T C 9: 123,119,293 L93P probably benign Het
F2 T C 2: 91,630,200 E316G probably benign Het
Fat4 A C 3: 38,999,109 Q4084P probably benign Het
Flywch1 T C 17: 23,762,370 K160E probably benign Het
Foxi2 A G 7: 135,411,730 T230A probably benign Het
Fthl17a A G X: 85,270,073 N154S possibly damaging Het
Hykk G A 9: 54,937,317 R222Q probably damaging Het
Ing4 A G 6: 125,043,960 E15G probably damaging Het
Irak1 T C X: 74,016,583 D679G probably damaging Het
Itga1 T C 13: 115,007,032 E321G probably benign Het
Kdelc2 T G 9: 53,390,711 L32R probably damaging Het
Nudt1 T A 5: 140,335,321 probably null Het
Nupl1 A G 14: 60,243,482 F138S probably damaging Het
Olfr122 A T 17: 37,771,913 M87L probably damaging Het
Olfr448 G T 6: 42,896,598 W49L probably benign Het
Pllp T C 8: 94,679,475 Y60C probably damaging Het
Pnpla7 T C 2: 24,997,255 V37A probably damaging Het
Psme4 A G 11: 30,807,797 H310R possibly damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Sash1 C T 10: 8,729,909 V906M probably benign Het
Scn1a A T 2: 66,299,784 I1212K probably damaging Het
Stbd1 A T 5: 92,605,130 S160C probably benign Het
Tex29 T C 8: 11,854,157 V99A probably benign Het
Tg A T 15: 66,725,144 N79I probably damaging Het
Tie1 T C 4: 118,482,663 D389G probably damaging Het
Vmn1r178 A G 7: 23,894,027 T167A possibly damaging Het
Xkr4 C T 1: 3,670,745 G202S possibly damaging Het
Other mutations in Il18rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Il18rap APN 1 40541921 missense probably benign 0.03
IGL01467:Il18rap APN 1 40548639 missense probably damaging 1.00
IGL01505:Il18rap APN 1 40537084 missense probably damaging 0.97
IGL02215:Il18rap APN 1 40547922 missense probably damaging 1.00
IGL03307:Il18rap APN 1 40543067 missense probably benign 0.01
BB006:Il18rap UTSW 1 40531580 missense probably damaging 1.00
BB007:Il18rap UTSW 1 40548643 missense probably damaging 0.99
BB016:Il18rap UTSW 1 40531580 missense probably damaging 1.00
BB017:Il18rap UTSW 1 40548643 missense probably damaging 0.99
R0136:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0299:Il18rap UTSW 1 40525058 missense probably benign 0.04
R0358:Il18rap UTSW 1 40549042 missense possibly damaging 0.53
R0499:Il18rap UTSW 1 40525058 missense probably benign 0.04
R1386:Il18rap UTSW 1 40531522 missense probably benign 0.00
R1817:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1818:Il18rap UTSW 1 40531527 missense probably benign 0.04
R1819:Il18rap UTSW 1 40531527 missense probably benign 0.04
R3721:Il18rap UTSW 1 40537088 missense probably damaging 1.00
R5634:Il18rap UTSW 1 40539376 intron probably benign
R5663:Il18rap UTSW 1 40531557 missense probably damaging 1.00
R5690:Il18rap UTSW 1 40537112 missense possibly damaging 0.73
R5825:Il18rap UTSW 1 40531566 missense probably benign 0.38
R6140:Il18rap UTSW 1 40525052 missense probably benign 0.04
R6291:Il18rap UTSW 1 40524889 missense probably benign 0.00
R6859:Il18rap UTSW 1 40525095 nonsense probably null
R6992:Il18rap UTSW 1 40542035 missense probably benign 0.00
R7317:Il18rap UTSW 1 40525376 missense probably damaging 0.98
R7402:Il18rap UTSW 1 40524951 missense probably benign 0.01
R7465:Il18rap UTSW 1 40543089 missense probably damaging 1.00
R7561:Il18rap UTSW 1 40524377 missense probably benign 0.00
R7929:Il18rap UTSW 1 40531580 missense probably damaging 1.00
R7930:Il18rap UTSW 1 40548643 missense probably damaging 0.99
R8151:Il18rap UTSW 1 40525268 missense probably benign 0.00
R8201:Il18rap UTSW 1 40539269 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CCATGACGGTAGCTTTCCTATGCAG -3'
(R):5'- GAGTGGCACACTGGGTGTTCTTAC -3'

Sequencing Primer
(F):5'- CAAGGTGCTGATGTGACTCC -3'
(R):5'- GGTGTTCTTACCCCCCAGAG -3'
Posted On2013-10-16