Incidental Mutation 'R3157:Pced1a'
ID 263528
Institutional Source Beutler Lab
Gene Symbol Pced1a
Ensembl Gene ENSMUSG00000037773
Gene Name PC-esterase domain containing 1A
Synonyms Fam113a, A930025D01Rik
MMRRC Submission 040608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3157 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 130417247-130424701 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 130419767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 322 (M322T)
Ref Sequence ENSEMBL: ENSMUSP00000105906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000089581] [ENSMUST00000110277] [ENSMUST00000128994]
AlphaFold Q6P1Z5
Predicted Effect probably benign
Transcript: ENSMUST00000028900
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089581
AA Change: M322T

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087009
Gene: ENSMUSG00000037773
AA Change: M322T

DomainStartEndE-ValueType
Pfam:PC-Esterase 18 267 4e-52 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110277
AA Change: M322T

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105906
Gene: ENSMUSG00000037773
AA Change: M322T

DomainStartEndE-ValueType
Pfam:PC-Esterase 21 268 3.8e-51 PFAM
low complexity region 308 346 N/A INTRINSIC
low complexity region 376 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125973
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153663
Meta Mutation Damage Score 0.0999 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the GDSL/SGNH superfamily. Members of this family are hydrolytic enzymes with esterase and lipase activity and broad substrate specificity. This protein belongs to the Pmr5-Cas1p-esterase subfamily in that it contains the catalytic triad comprised of serine, aspartate and histidine and lacks two conserved regions (glycine after strand S2 and GxND motif). A pseudogene of this gene has been identified on the long arm of chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,697,633 K408N probably benign Het
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ap1g2 A T 14: 55,099,274 I747N probably damaging Het
Arhgap27 T A 11: 103,333,837 probably null Het
Bmp1 G T 14: 70,492,107 N541K possibly damaging Het
Cacna1c T A 6: 118,751,524 T320S probably benign Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
D630003M21Rik A C 2: 158,195,472 probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dock8 T C 19: 25,149,831 Y1058H probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Fnip2 T C 3: 79,567,594 T4A probably damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmcn2 A G 2: 31,400,255 N2367D probably damaging Het
Hydin A G 8: 110,267,373 K13R unknown Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kcns1 G A 2: 164,164,945 A366V probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Klrb1c G T 6: 128,784,739 T134K possibly damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mgat4d T C 8: 83,354,821 Y68H probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Ncapg T A 5: 45,676,058 D295E probably benign Het
Npas2 C T 1: 39,347,609 T653M possibly damaging Het
Nps A G 7: 135,272,260 D53G probably benign Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Pcdha2 A G 18: 36,940,092 T259A probably damaging Het
Pcgf6 T C 19: 47,040,036 probably benign Het
Pigg C T 5: 108,314,148 T115I probably damaging Het
Plcd4 G A 1: 74,551,154 probably null Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Rasal2 A G 1: 157,158,655 probably benign Het
Rec8 A G 14: 55,625,306 E574G probably damaging Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Slc16a8 T C 15: 79,252,175 I276V probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Synpr C T 14: 13,493,614 A64V possibly damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tpt1 G A 14: 75,846,400 probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Ttll4 T C 1: 74,697,611 L1165P possibly damaging Het
Other mutations in Pced1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pced1a APN 2 130419178 missense probably benign 0.00
IGL02173:Pced1a APN 2 130422328 missense possibly damaging 0.46
IGL02547:Pced1a APN 2 130419707 missense possibly damaging 0.74
IGL02729:Pced1a APN 2 130421903 missense probably benign 0.01
IGL03107:Pced1a APN 2 130422835 missense possibly damaging 0.81
R0139:Pced1a UTSW 2 130421907 missense probably benign 0.00
R0550:Pced1a UTSW 2 130419633 missense probably benign 0.00
R0578:Pced1a UTSW 2 130419843 missense probably damaging 0.98
R3037:Pced1a UTSW 2 130419859 missense probably benign 0.40
R4578:Pced1a UTSW 2 130422676 missense probably damaging 1.00
R5306:Pced1a UTSW 2 130419171 missense probably benign
R6210:Pced1a UTSW 2 130421919 missense probably damaging 1.00
R7444:Pced1a UTSW 2 130422059 missense probably damaging 0.98
R7459:Pced1a UTSW 2 130419824 missense possibly damaging 0.59
R7524:Pced1a UTSW 2 130422028 missense probably benign 0.44
R7744:Pced1a UTSW 2 130422052 missense probably damaging 1.00
R7782:Pced1a UTSW 2 130422515 missense probably damaging 0.99
R7851:Pced1a UTSW 2 130422316 missense probably damaging 0.99
R8300:Pced1a UTSW 2 130424237 unclassified probably benign
R8404:Pced1a UTSW 2 130423657 unclassified probably benign
R8502:Pced1a UTSW 2 130423657 unclassified probably benign
R8990:Pced1a UTSW 2 130422551 missense probably damaging 1.00
Z1177:Pced1a UTSW 2 130422628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATCCCTGAGCTCACATG -3'
(R):5'- GAAGTATGGGTAGCCAGCATTTG -3'

Sequencing Primer
(F):5'- ACATGAGCACAGGTGGCC -3'
(R):5'- CATTCATTCCAGGGAAGC -3'
Posted On 2015-02-05