Incidental Mutation 'R3157:Dock8'
ID263570
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Namededicator of cytokinesis 8
SynonymsA130095G14Rik, 5830472H07Rik, 1200017A24Rik
MMRRC Submission 040608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R3157 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location24999529-25202432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25149831 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1058 (Y1058H)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: Y1058H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: Y1058H

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Meta Mutation Damage Score 0.1063 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,697,633 K408N probably benign Het
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ap1g2 A T 14: 55,099,274 I747N probably damaging Het
Arhgap27 T A 11: 103,333,837 probably null Het
Bmp1 G T 14: 70,492,107 N541K possibly damaging Het
Cacna1c T A 6: 118,751,524 T320S probably benign Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
D630003M21Rik A C 2: 158,195,472 probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Fnip2 T C 3: 79,567,594 T4A probably damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmcn2 A G 2: 31,400,255 N2367D probably damaging Het
Hydin A G 8: 110,267,373 K13R unknown Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcns1 G A 2: 164,164,945 A366V probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Klrb1c G T 6: 128,784,739 T134K possibly damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mgat4d T C 8: 83,354,821 Y68H probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Ncapg T A 5: 45,676,058 D295E probably benign Het
Npas2 C T 1: 39,347,609 T653M possibly damaging Het
Nps A G 7: 135,272,260 D53G probably benign Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Pcdha2 A G 18: 36,940,092 T259A probably damaging Het
Pced1a A G 2: 130,419,767 M322T probably benign Het
Pcgf6 T C 19: 47,040,036 probably benign Het
Pigg C T 5: 108,314,148 T115I probably damaging Het
Plcd4 G A 1: 74,551,154 probably null Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Rasal2 A G 1: 157,158,655 probably benign Het
Rec8 A G 14: 55,625,306 E574G probably damaging Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Slc16a8 T C 15: 79,252,175 I276V probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Synpr C T 14: 13,493,614 A64V possibly damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tpt1 G A 14: 75,846,400 probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Ttll4 T C 1: 74,697,611 L1165P possibly damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
hillock UTSW 19 25174333 critical splice donor site probably null
Molehill UTSW 19 25130461 missense probably damaging 1.00
Pap UTSW 19 25122441 missense probably benign 0.31
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null 0.95
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25154242 missense probably damaging 1.00
R8160:Dock8 UTSW 19 25147347 missense probably damaging 1.00
R8287:Dock8 UTSW 19 25130461 missense probably damaging 1.00
R8295:Dock8 UTSW 19 25123236 missense probably benign 0.04
R8443:Dock8 UTSW 19 25155917 missense probably benign 0.04
R8537:Dock8 UTSW 19 25130506 missense probably benign 0.00
R8673:Dock8 UTSW 19 25183503 missense probably damaging 0.96
R8709:Dock8 UTSW 19 25078084 nonsense probably null
X0027:Dock8 UTSW 19 25161129 missense probably benign
Z1177:Dock8 UTSW 19 25132123 missense probably benign 0.05
Z1177:Dock8 UTSW 19 25155972 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGCATGTACAGAACAAGACCG -3'
(R):5'- ATCCAGGGTAGCCAAAGGAC -3'

Sequencing Primer
(F):5'- CATGTACAGAACAAGACCGATGGG -3'
(R):5'- CGCACACTCTACAGATGGTG -3'
Posted On2015-02-05