Incidental Mutation 'R3157:Ncapg'
ID263535
Institutional Source Beutler Lab
Gene Symbol Ncapg
Ensembl Gene ENSMUSG00000015880
Gene Namenon-SMC condensin I complex, subunit G
Synonyms5730507H05Rik, MFT.M05.13, Hcapg
MMRRC Submission 040608-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R3157 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location45669919-45700546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45676058 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 295 (D295E)
Ref Sequence ENSEMBL: ENSMUSP00000112871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117396]
Predicted Effect probably benign
Transcript: ENSMUST00000117396
AA Change: D295E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112871
Gene: ENSMUSG00000015880
AA Change: D295E

DomainStartEndE-ValueType
Pfam:Cnd3 557 863 7.4e-87 PFAM
low complexity region 864 874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198274
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the condensin complex, which is responsible for the condensation and stabilization of chromosomes during mitosis and meiosis. Phosphorylation of the encoded protein activates the condensin complex. There are pseudogenes for this gene on chromosomes 8 and 15. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,697,633 K408N probably benign Het
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ap1g2 A T 14: 55,099,274 I747N probably damaging Het
Arhgap27 T A 11: 103,333,837 probably null Het
Bmp1 G T 14: 70,492,107 N541K possibly damaging Het
Cacna1c T A 6: 118,751,524 T320S probably benign Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
D630003M21Rik A C 2: 158,195,472 probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dock8 T C 19: 25,149,831 Y1058H probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Fnip2 T C 3: 79,567,594 T4A probably damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmcn2 A G 2: 31,400,255 N2367D probably damaging Het
Hydin A G 8: 110,267,373 K13R unknown Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcns1 G A 2: 164,164,945 A366V probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Klrb1c G T 6: 128,784,739 T134K possibly damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mgat4d T C 8: 83,354,821 Y68H probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Npas2 C T 1: 39,347,609 T653M possibly damaging Het
Nps A G 7: 135,272,260 D53G probably benign Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Pcdha2 A G 18: 36,940,092 T259A probably damaging Het
Pced1a A G 2: 130,419,767 M322T probably benign Het
Pcgf6 T C 19: 47,040,036 probably benign Het
Pigg C T 5: 108,314,148 T115I probably damaging Het
Plcd4 G A 1: 74,551,154 probably null Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Rasal2 A G 1: 157,158,655 probably benign Het
Rec8 A G 14: 55,625,306 E574G probably damaging Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Slc16a8 T C 15: 79,252,175 I276V probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Synpr C T 14: 13,493,614 A64V possibly damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tpt1 G A 14: 75,846,400 probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Ttll4 T C 1: 74,697,611 L1165P possibly damaging Het
Other mutations in Ncapg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ncapg APN 5 45693160 missense possibly damaging 0.53
IGL00777:Ncapg APN 5 45695765 missense possibly damaging 0.93
IGL00857:Ncapg APN 5 45676585 splice site probably null
IGL00916:Ncapg APN 5 45671192 missense probably benign 0.37
IGL01293:Ncapg APN 5 45681854 missense probably benign 0.01
IGL01360:Ncapg APN 5 45674385 nonsense probably null
IGL01462:Ncapg APN 5 45671135 missense probably benign 0.02
IGL01527:Ncapg APN 5 45672384 missense possibly damaging 0.71
IGL01732:Ncapg APN 5 45693853 missense probably damaging 1.00
IGL01788:Ncapg APN 5 45671081 missense probably damaging 0.97
IGL01871:Ncapg APN 5 45688581 missense probably benign 0.09
IGL03106:Ncapg APN 5 45695668 missense probably damaging 1.00
IGL03124:Ncapg APN 5 45671209 missense probably benign
R0086:Ncapg UTSW 5 45676744 splice site probably null
R0109:Ncapg UTSW 5 45693748 splice site probably null
R0110:Ncapg UTSW 5 45693147 unclassified probably benign
R0377:Ncapg UTSW 5 45693817 missense probably benign
R0432:Ncapg UTSW 5 45672428 missense probably damaging 0.99
R0637:Ncapg UTSW 5 45687324 missense probably damaging 1.00
R0835:Ncapg UTSW 5 45681448 missense probably damaging 0.96
R0894:Ncapg UTSW 5 45679894 missense probably null 0.24
R1069:Ncapg UTSW 5 45675930 intron probably benign
R1216:Ncapg UTSW 5 45699919 missense possibly damaging 0.68
R1967:Ncapg UTSW 5 45699910 missense probably damaging 0.99
R2396:Ncapg UTSW 5 45678373 missense probably benign 0.00
R3735:Ncapg UTSW 5 45696127 missense probably benign 0.00
R3736:Ncapg UTSW 5 45696127 missense probably benign 0.00
R3887:Ncapg UTSW 5 45674363 missense probably benign
R4371:Ncapg UTSW 5 45678455 missense probably benign
R4545:Ncapg UTSW 5 45671212 missense probably damaging 1.00
R4546:Ncapg UTSW 5 45671212 missense probably damaging 1.00
R4558:Ncapg UTSW 5 45676644 missense probably benign 0.00
R4615:Ncapg UTSW 5 45687399 missense probably benign 0.00
R4938:Ncapg UTSW 5 45671209 missense probably benign
R5839:Ncapg UTSW 5 45672278 missense probably damaging 0.99
R5871:Ncapg UTSW 5 45695697 missense probably damaging 1.00
R6086:Ncapg UTSW 5 45693236 missense probably damaging 1.00
R6418:Ncapg UTSW 5 45681816 missense probably damaging 1.00
R6617:Ncapg UTSW 5 45670132 missense probably benign 0.03
R7145:Ncapg UTSW 5 45670030 missense possibly damaging 0.82
R7408:Ncapg UTSW 5 45695793 missense probably benign 0.00
R7443:Ncapg UTSW 5 45672310 missense probably benign 0.31
R7463:Ncapg UTSW 5 45694092 intron probably null
R7509:Ncapg UTSW 5 45696108 missense probably benign 0.01
R7687:Ncapg UTSW 5 45699885 missense probably benign 0.03
R8022:Ncapg UTSW 5 45681794 missense probably damaging 1.00
R8177:Ncapg UTSW 5 45693753 missense probably benign 0.00
R8261:Ncapg UTSW 5 45687388 missense possibly damaging 0.90
R8263:Ncapg UTSW 5 45691792 missense probably benign 0.44
RF019:Ncapg UTSW 5 45698856 missense probably benign 0.00
Z1088:Ncapg UTSW 5 45679880 missense probably damaging 1.00
Z1177:Ncapg UTSW 5 45672502 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGTTAGGATGGGGCTTCC -3'
(R):5'- AGTCCTTGTACCAGAGGGAAG -3'

Sequencing Primer
(F):5'- TGGGGCTTCCATGGGGG -3'
(R):5'- TTGTACCAGAGGGAAGAAAAACTCTC -3'
Posted On2015-02-05