Incidental Mutation 'R3421:Slc25a17'
ID267062
Institutional Source Beutler Lab
Gene Symbol Slc25a17
Ensembl Gene ENSMUSG00000022404
Gene Namesolute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17
Synonyms34kDa, PMP34
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R3421 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81318911-81360812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81360700 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 11 (V11I)
Ref Sequence ENSEMBL: ENSMUSP00000155823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023039] [ENSMUST00000023040] [ENSMUST00000172107] [ENSMUST00000230309] [ENSMUST00000231140]
Predicted Effect probably benign
Transcript: ENSMUST00000023039
SMART Domains Protein: ENSMUSP00000023039
Gene: ENSMUSG00000022403

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 72 N/A INTRINSIC
TPR 104 137 1.2e1 SMART
TPR 138 171 6.95e-4 SMART
TPR 172 205 4.8e1 SMART
coiled coil region 225 264 N/A INTRINSIC
low complexity region 271 305 N/A INTRINSIC
STI1 312 351 3.37e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000023040
AA Change: V11I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000023040
Gene: ENSMUSG00000022404
AA Change: V11I

DomainStartEndE-ValueType
Pfam:Mito_carr 6 97 1e-17 PFAM
Pfam:Mito_carr 97 197 6.3e-24 PFAM
Pfam:Mito_carr 199 297 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172107
SMART Domains Protein: ENSMUSP00000130195
Gene: ENSMUSG00000022403

DomainStartEndE-ValueType
PDB:4J8C|B 1 44 6e-25 PDB
low complexity region 52 66 N/A INTRINSIC
low complexity region 71 81 N/A INTRINSIC
TPR 113 146 1.2e1 SMART
TPR 147 180 6.95e-4 SMART
TPR 181 214 4.8e1 SMART
coiled coil region 234 273 N/A INTRINSIC
low complexity region 280 314 N/A INTRINSIC
STI1 321 360 3.37e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229617
Predicted Effect unknown
Transcript: ENSMUST00000230309
AA Change: V10I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231078
Predicted Effect probably benign
Transcript: ENSMUST00000231140
AA Change: V11I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0997 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peroxisomal membrane protein that belongs to the family of mitochondrial solute carriers. It is expressed in the liver, and is likely involved in transport. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Telo2 C T 17: 25,110,752 R262Q probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Slc25a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Slc25a17 APN 15 81327326 nonsense probably null
IGL02655:Slc25a17 APN 15 81323643 missense probably benign 0.02
IGL03258:Slc25a17 APN 15 81329042 splice site probably benign
big_guy UTSW 15 81360774 utr 5 prime probably benign
R0114:Slc25a17 UTSW 15 81337959 missense probably damaging 1.00
R0763:Slc25a17 UTSW 15 81323706 splice site probably benign
R1628:Slc25a17 UTSW 15 81360724 missense possibly damaging 0.92
R2179:Slc25a17 UTSW 15 81337950 missense probably benign 0.02
R3420:Slc25a17 UTSW 15 81360700 missense probably benign 0.04
R3687:Slc25a17 UTSW 15 81327284 missense probably benign 0.01
R3688:Slc25a17 UTSW 15 81327284 missense probably benign 0.01
R4707:Slc25a17 UTSW 15 81327326 missense probably damaging 0.97
R5617:Slc25a17 UTSW 15 81360774 utr 5 prime probably benign
R5650:Slc25a17 UTSW 15 81329176 splice site probably null
R5817:Slc25a17 UTSW 15 81327060 missense probably damaging 0.97
R6207:Slc25a17 UTSW 15 81329064 missense probably damaging 1.00
R6727:Slc25a17 UTSW 15 81337953 missense probably benign 0.05
R7331:Slc25a17 UTSW 15 81329145 missense probably damaging 1.00
R8101:Slc25a17 UTSW 15 81338047 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATAGTCCAGACAGTCTCTG -3'
(R):5'- CGTTCCTGGGCATTTCACAC -3'

Sequencing Primer
(F):5'- CAGACAGTCTCTGGGAAAGTCC -3'
(R):5'- GGGCATTTCACACTCGCC -3'
Posted On2015-02-18