Incidental Mutation 'R3435:Fam47e'
ID267155
Institutional Source Beutler Lab
Gene Symbol Fam47e
Ensembl Gene ENSMUSG00000057068
Gene Namefamily with sequence similarity 47, member E
SynonymsGm1381, LOC384198
MMRRC Submission 040653-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3435 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92555069-92591279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92585362 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 152 (V152D)
Ref Sequence ENSEMBL: ENSMUSP00000135051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082382] [ENSMUST00000131166] [ENSMUST00000146417] [ENSMUST00000175974] [ENSMUST00000176448] [ENSMUST00000176621]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082382
AA Change: V125D

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080987
Gene: ENSMUSG00000057068
AA Change: V125D

DomainStartEndE-ValueType
low complexity region 136 150 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131166
AA Change: V186D

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118033
Gene: ENSMUSG00000057068
AA Change: V186D

DomainStartEndE-ValueType
low complexity region 197 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146417
AA Change: V328D

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115229
Gene: ENSMUSG00000057068
AA Change: V328D

DomainStartEndE-ValueType
Pfam:FAM47 17 191 1.7e-31 PFAM
low complexity region 339 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149617
Predicted Effect probably benign
Transcript: ENSMUST00000175974
Predicted Effect probably damaging
Transcript: ENSMUST00000176448
AA Change: V152D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000176621
Meta Mutation Damage Score 0.2573 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A C 2: 68,601,845 D91A unknown Het
Abca9 T C 11: 110,154,430 E359G probably benign Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Dnah1 T C 14: 31,316,674 D150G probably damaging Het
Gm19965 C A 1: 116,821,623 H345N possibly damaging Het
Ift74 A G 4: 94,621,852 probably null Het
Iqgap3 A G 3: 88,094,604 I384V probably benign Het
Lrrc57 T A 2: 120,609,381 probably benign Het
Mafk C T 5: 139,800,307 Q87* probably null Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mup6 G T 4: 60,004,116 probably null Het
Neurl1a T C 19: 47,257,525 V532A probably damaging Het
Nod2 A G 8: 88,664,009 R293G possibly damaging Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr3 T A 2: 36,812,678 Q138L probably benign Het
Osbpl3 A T 6: 50,348,070 N149K possibly damaging Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Pbxip1 T C 3: 89,447,236 L354P probably damaging Het
Pld1 A T 3: 28,124,623 M889L probably benign Het
Ppp2r2b T A 18: 42,741,109 Q52L possibly damaging Het
Prob1 T C 18: 35,654,241 E320G possibly damaging Het
Stard13 A T 5: 151,042,179 L937Q probably damaging Het
Strn4 T C 7: 16,837,633 S563P possibly damaging Het
Syne1 T C 10: 5,348,565 D1114G probably damaging Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Tmx3 T A 18: 90,527,904 V203E probably damaging Het
Ttn T C 2: 76,878,718 probably benign Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Other mutations in Fam47e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Fam47e APN 5 92579663 missense probably damaging 1.00
R0646:Fam47e UTSW 5 92578458 intron probably benign
R1170:Fam47e UTSW 5 92565922 splice site probably benign
R1216:Fam47e UTSW 5 92562484 missense probably damaging 0.99
R1926:Fam47e UTSW 5 92585385 missense possibly damaging 0.61
R3434:Fam47e UTSW 5 92585362 missense probably damaging 0.99
R4899:Fam47e UTSW 5 92574669 missense probably benign 0.23
R4925:Fam47e UTSW 5 92585290 missense probably damaging 1.00
R5885:Fam47e UTSW 5 92565968 missense probably damaging 0.97
R6060:Fam47e UTSW 5 92579613 missense possibly damaging 0.88
R6278:Fam47e UTSW 5 92562517 missense probably damaging 1.00
R6964:Fam47e UTSW 5 92566052 missense probably damaging 1.00
R7661:Fam47e UTSW 5 92587525 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCCTTTGATATTTGAAACGACCAAC -3'
(R):5'- CCGTGTTTACCATGAAGGCAG -3'

Sequencing Primer
(F):5'- TTTGAAACGACCAACCAACTACTAAG -3'
(R):5'- GGCAGAATTCAAGCCTTGC -3'
Posted On2015-02-18