Incidental Mutation 'R3623:Bscl2'
ID268761
Institutional Source Beutler Lab
Gene Symbol Bscl2
Ensembl Gene ENSMUSG00000071657
Gene NameBerardinelli-Seip congenital lipodystrophy 2 (seipin)
Synonymsseipin, Gng3lg
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3623 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location8837467-8848683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8841150 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 40 (C40S)
Ref Sequence ENSEMBL: ENSMUSP00000125250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086058] [ENSMUST00000096259] [ENSMUST00000159634] [ENSMUST00000160556] [ENSMUST00000160897] [ENSMUST00000171649]
Predicted Effect probably benign
Transcript: ENSMUST00000086058
SMART Domains Protein: ENSMUSP00000083224
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096259
SMART Domains Protein: ENSMUSP00000093978
Gene: ENSMUSG00000071658

DomainStartEndE-ValueType
G_gamma 9 75 1.21e-24 SMART
GGL 13 75 1.68e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159571
Predicted Effect probably benign
Transcript: ENSMUST00000159634
SMART Domains Protein: ENSMUSP00000125422
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159770
Predicted Effect probably benign
Transcript: ENSMUST00000160556
SMART Domains Protein: ENSMUSP00000123976
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160897
AA Change: C40S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125250
Gene: ENSMUSG00000071657
AA Change: C40S

DomainStartEndE-ValueType
Pfam:Seipin 97 208 2.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162580
Predicted Effect probably benign
Transcript: ENSMUST00000171649
AA Change: C40S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127685
Gene: ENSMUSG00000071657
AA Change: C40S

DomainStartEndE-ValueType
Pfam:Seipin 99 302 8.5e-66 PFAM
Blast:PAC 329 366 2e-6 BLAST
low complexity region 413 431 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the multi-pass transmembrane protein protein seipin. This protein localizes to the endoplasmic reticulum and may be important for lipid droplet morphology. Mutations in this gene have been associated with congenital generalized lipodystrophy type 2 or Berardinelli-Seip syndrome, a rare autosomal recessive disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2).[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe generalized lipodystrophy with hepatic steatosis, glucose intolerance, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Camk2g G A 14: 20,755,707 probably benign Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cep135 G A 5: 76,624,739 G657D probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Ephx1 A G 1: 180,989,933 I391T probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fcgbp A G 7: 28,101,276 Y1249C probably damaging Het
Gm38100 T C 1: 175,920,631 C88R possibly damaging Het
Gm5592 T C 7: 41,157,628 probably benign Het
Gm7964 A G 7: 83,756,421 N149S probably benign Het
Greb1l T A 18: 10,542,380 I1325N probably damaging Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Mdfic T A 6: 15,770,320 N108K probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mettl21e T A 1: 44,206,697 I130F probably damaging Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Msrb3 C T 10: 120,784,198 R72H probably damaging Het
Mtmr11 A G 3: 96,165,266 H324R probably damaging Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nr1i2 A G 16: 38,265,907 probably benign Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Olfr305 A G 7: 86,364,100 F79S probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcnt T A 10: 76,433,750 E228V probably benign Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Pkhd1l1 A T 15: 44,526,869 K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Thbd A G 2: 148,406,973 V325A probably damaging Het
Trpd52l3 T A 19: 30,003,933 C29* probably null Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Usp35 T C 7: 97,312,620 H533R probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Zap70 C T 1: 36,779,135 T301I probably benign Het
Zfp341 A G 2: 154,624,881 K57E probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zfp786 T C 6: 47,821,423 N194D probably benign Het
Other mutations in Bscl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01908:Bscl2 APN 19 8845276 missense probably damaging 0.99
IGL03206:Bscl2 APN 19 8843089 missense probably damaging 0.97
R0193:Bscl2 UTSW 19 8847429 missense probably benign 0.21
R1112:Bscl2 UTSW 19 8839734 missense possibly damaging 0.90
R1513:Bscl2 UTSW 19 8841145 missense probably damaging 1.00
R2049:Bscl2 UTSW 19 8845320 splice site probably null
R2121:Bscl2 UTSW 19 8839782 nonsense probably null
R2140:Bscl2 UTSW 19 8845320 splice site probably null
R2142:Bscl2 UTSW 19 8845320 splice site probably null
R2483:Bscl2 UTSW 19 8841150 missense probably benign 0.01
R4177:Bscl2 UTSW 19 8839756 missense possibly damaging 0.85
R4675:Bscl2 UTSW 19 8848159 missense possibly damaging 0.81
R4967:Bscl2 UTSW 19 8847980 missense probably benign 0.02
R5051:Bscl2 UTSW 19 8845279 nonsense probably null
R5446:Bscl2 UTSW 19 8846200 missense possibly damaging 0.91
R6493:Bscl2 UTSW 19 8839774 missense probably damaging 1.00
R6838:Bscl2 UTSW 19 8841381 missense probably damaging 1.00
R7117:Bscl2 UTSW 19 8848514 missense possibly damaging 0.68
R7401:Bscl2 UTSW 19 8846550 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- AGCGCATGTGAAGCAATGAC -3'
(R):5'- CTGTAGTGGAAGTGCACAGG -3'

Sequencing Primer
(F):5'- AATGACTTTGCTTTGCCCTG -3'
(R):5'- CCGTCGGCATGTAGGAGTAG -3'
Posted On2015-02-19