Incidental Mutation 'R3698:Olfr366'
ID269875
Institutional Source Beutler Lab
Gene Symbol Olfr366
Ensembl Gene ENSMUSG00000068947
Gene Nameolfactory receptor 366
SynonymsGA_x6K02T2NLDC-33902472-33903401, MOR138-6, MOR138-5P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3698 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37211574-37224506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37220176 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 229 (P229L)
Ref Sequence ENSEMBL: ENSMUSP00000150608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091001] [ENSMUST00000214897]
Predicted Effect probably damaging
Transcript: ENSMUST00000091001
AA Change: P229L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088524
Gene: ENSMUSG00000068947
AA Change: P229L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5e-62 PFAM
Pfam:7tm_1 41 290 3.7e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214897
AA Change: P229L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.5617 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 C A 19: 56,916,523 S549I possibly damaging Het
Aldh4a1 A G 4: 139,642,251 H371R possibly damaging Het
Arpc1a G T 5: 145,096,191 K103N probably damaging Het
Btg3 A G 16: 78,364,834 S136P probably benign Het
Ckap5 C A 2: 91,620,166 T2014K probably benign Het
Emc1 T G 4: 139,365,386 S546A possibly damaging Het
Fam45a A G 19: 60,832,616 probably null Het
G3bp2 T C 5: 92,056,280 E316G possibly damaging Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Il6st T G 13: 112,504,382 D897E probably benign Het
Ipo13 A G 4: 117,900,693 L767P probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl13 G A X: 23,248,183 T94I probably benign Het
Morc2a A T 11: 3,679,672 K364* probably null Het
Nat8f2 T A 6: 85,867,796 T195S probably benign Het
Nckipsd G A 9: 108,811,121 G83S probably damaging Het
Nfu1 A G 6: 87,015,652 T83A probably damaging Het
Nid1 G A 13: 13,486,759 C748Y probably damaging Het
Olfr1138 T C 2: 87,738,016 T103A probably benign Het
Rgs22 C T 15: 36,099,892 V226I probably benign Het
Slc13a4 T A 6: 35,274,957 I467F probably benign Het
Stat2 T A 10: 128,278,793 L253Q probably benign Het
Tnxb G T 17: 34,690,433 probably null Het
Ttn C T 2: 76,734,251 R28514H probably damaging Het
Usp15 T C 10: 123,181,738 D51G probably damaging Het
Uvrag T C 7: 98,939,943 E417G probably damaging Het
Other mutations in Olfr366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Olfr366 APN 2 37220026 missense probably damaging 1.00
IGL01925:Olfr366 APN 2 37220046 missense probably benign 0.14
IGL02355:Olfr366 APN 2 37219669 missense probably damaging 1.00
IGL02362:Olfr366 APN 2 37219669 missense probably damaging 1.00
IGL02671:Olfr366 APN 2 37220245 missense probably damaging 1.00
IGL02821:Olfr366 APN 2 37220100 missense probably damaging 1.00
R0603:Olfr366 UTSW 2 37220106 missense probably damaging 1.00
R0707:Olfr366 UTSW 2 37220196 nonsense probably null
R1204:Olfr366 UTSW 2 37219639 missense probably benign
R1457:Olfr366 UTSW 2 37219659 missense possibly damaging 0.95
R1509:Olfr366 UTSW 2 37219954 missense probably damaging 1.00
R1676:Olfr366 UTSW 2 37219641 nonsense probably null
R1823:Olfr366 UTSW 2 37220332 missense probably damaging 0.96
R2163:Olfr366 UTSW 2 37220077 missense probably damaging 1.00
R2909:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R3696:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R4004:Olfr366 UTSW 2 37219948 missense probably benign 0.00
R4655:Olfr366 UTSW 2 37219873 missense probably benign 0.03
R5311:Olfr366 UTSW 2 37219621 missense probably benign 0.00
R5385:Olfr366 UTSW 2 37219587 missense possibly damaging 0.77
R5433:Olfr366 UTSW 2 37219672 missense probably damaging 1.00
R5499:Olfr366 UTSW 2 37219765 missense possibly damaging 0.81
R5707:Olfr366 UTSW 2 37219889 missense probably benign 0.00
R6330:Olfr366 UTSW 2 37220124 missense probably benign 0.00
R6338:Olfr366 UTSW 2 37219822 missense probably damaging 1.00
R6666:Olfr366 UTSW 2 37220319 missense probably damaging 1.00
R6872:Olfr366 UTSW 2 37219977 missense possibly damaging 0.60
R7412:Olfr366 UTSW 2 37219762 missense possibly damaging 0.48
R7789:Olfr366 UTSW 2 37219660 missense probably benign 0.01
R7831:Olfr366 UTSW 2 37219711 missense probably damaging 0.98
R8220:Olfr366 UTSW 2 37219779 missense probably benign 0.06
R8391:Olfr366 UTSW 2 37220265 missense probably damaging 1.00
R8708:Olfr366 UTSW 2 37219944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAATTCTCATGGGTCGCC -3'
(R):5'- TGTTCCTAAGGCTGTAGATGAAAGG -3'

Sequencing Primer
(F):5'- TGTGGACCCAATGTCATTCATCAC -3'
(R):5'- GGATTCAGCATTGGGGTAACTAC -3'
Posted On2015-03-18