Incidental Mutation 'R5707:Olfr366'
ID452005
Institutional Source Beutler Lab
Gene Symbol Olfr366
Ensembl Gene ENSMUSG00000068947
Gene Nameolfactory receptor 366
SynonymsGA_x6K02T2NLDC-33902472-33903401, MOR138-6, MOR138-5P
MMRRC Submission 043332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R5707 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37211574-37224506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37219889 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 133 (N133K)
Ref Sequence ENSEMBL: ENSMUSP00000150608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091001] [ENSMUST00000214897]
Predicted Effect probably benign
Transcript: ENSMUST00000091001
AA Change: N133K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088524
Gene: ENSMUSG00000068947
AA Change: N133K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5e-62 PFAM
Pfam:7tm_1 41 290 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214897
AA Change: N133K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,173,312 N93S probably benign Het
9330182L06Rik A G 5: 9,441,698 Y686C probably damaging Het
Abca13 T C 11: 9,510,620 L4210P probably damaging Het
Adcy6 T C 15: 98,598,741 T518A probably damaging Het
Adgb C T 10: 10,391,757 V940I probably damaging Het
Aqp11 A G 7: 97,737,428 V187A possibly damaging Het
Arhgef15 A G 11: 68,954,715 S104P probably damaging Het
BC027072 G T 17: 71,751,572 A370E possibly damaging Het
Birc6 T A 17: 74,696,404 N4762K probably damaging Het
Cacna1e T C 1: 154,633,717 D264G probably damaging Het
Cela3b G T 4: 137,424,856 Q97K probably damaging Het
Cenpc1 T A 5: 86,035,434 R499W possibly damaging Het
Cnr1 C A 4: 33,944,330 C239* probably null Het
Col6a2 T C 10: 76,611,031 K348E possibly damaging Het
Ctnnb1 C A 9: 120,955,168 L368I probably benign Het
Diras1 T C 10: 81,022,081 E112G probably benign Het
Dopey1 T A 9: 86,502,997 M332K possibly damaging Het
Dpy19l1 T C 9: 24,414,267 *747W probably null Het
Dydc2 T G 14: 41,061,954 T71P probably damaging Het
Ggt1 T A 10: 75,585,238 I429N probably benign Het
Gm5114 G C 7: 39,411,276 L50V probably benign Het
Gm5121 T G 9: 57,334,483 noncoding transcript Het
Kidins220 A G 12: 25,013,391 D933G probably damaging Het
Kirrel3 A G 9: 35,013,276 K286R probably damaging Het
Klf5 T C 14: 99,301,508 I39T probably benign Het
Krt14 C T 11: 100,204,758 V274I possibly damaging Het
Meiob A G 17: 24,835,051 D364G probably benign Het
Mroh7 T A 4: 106,681,885 E1190D possibly damaging Het
Mtmr7 T C 8: 40,558,162 E285G possibly damaging Het
Nhsl1 C T 10: 18,526,503 T1159M probably damaging Het
Olfr1360 A G 13: 21,674,599 L115P probably damaging Het
Olfr382 G T 11: 73,516,625 D191E probably damaging Het
Pdlim5 T A 3: 142,304,299 H294L probably damaging Het
Pdzd8 A T 19: 59,299,625 D1114E probably benign Het
Phf20 T G 2: 156,296,771 probably null Het
Plec C T 15: 76,199,671 probably benign Het
Ppp1r18 T C 17: 35,867,236 M1T probably null Het
Ppp4r3a G A 12: 101,058,511 T243I probably damaging Het
Prss41 C T 17: 23,842,416 V134I probably benign Het
Pter T C 2: 12,978,180 probably benign Het
Rasgef1b T G 5: 99,234,602 K176N possibly damaging Het
Reps1 T A 10: 18,056,010 D16E probably benign Het
Slc4a5 T A 6: 83,261,415 D73E probably benign Het
Smgc A T 15: 91,860,663 T146S possibly damaging Het
Sptbn1 A T 11: 30,143,174 W396R possibly damaging Het
Stkld1 A G 2: 26,943,987 E162G probably damaging Het
Tanc1 T C 2: 59,758,530 F106L probably benign Het
Tarbp1 A G 8: 126,467,144 Y340H probably damaging Het
Tenm2 T C 11: 36,047,182 I1556V possibly damaging Het
Tmem64 T C 4: 15,266,288 C113R probably damaging Het
Try4 T C 6: 41,305,043 F188L possibly damaging Het
Ttc25 G A 11: 100,554,061 A348T probably damaging Het
Ucn3 A G 13: 3,941,556 V32A probably benign Het
Vmn2r83 T A 10: 79,491,349 M597K possibly damaging Het
Wdr90 A G 17: 25,857,192 V491A probably benign Het
Xylt1 T A 7: 117,656,494 M763K possibly damaging Het
Zfp507 G T 7: 35,794,163 A485E probably damaging Het
Other mutations in Olfr366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Olfr366 APN 2 37220026 missense probably damaging 1.00
IGL01925:Olfr366 APN 2 37220046 missense probably benign 0.14
IGL02355:Olfr366 APN 2 37219669 missense probably damaging 1.00
IGL02362:Olfr366 APN 2 37219669 missense probably damaging 1.00
IGL02671:Olfr366 APN 2 37220245 missense probably damaging 1.00
IGL02821:Olfr366 APN 2 37220100 missense probably damaging 1.00
R0603:Olfr366 UTSW 2 37220106 missense probably damaging 1.00
R0707:Olfr366 UTSW 2 37220196 nonsense probably null
R1204:Olfr366 UTSW 2 37219639 missense probably benign
R1457:Olfr366 UTSW 2 37219659 missense possibly damaging 0.95
R1509:Olfr366 UTSW 2 37219954 missense probably damaging 1.00
R1676:Olfr366 UTSW 2 37219641 nonsense probably null
R1823:Olfr366 UTSW 2 37220332 missense probably damaging 0.96
R2163:Olfr366 UTSW 2 37220077 missense probably damaging 1.00
R2909:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R3696:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R3698:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R4004:Olfr366 UTSW 2 37219948 missense probably benign 0.00
R4655:Olfr366 UTSW 2 37219873 missense probably benign 0.03
R5311:Olfr366 UTSW 2 37219621 missense probably benign 0.00
R5385:Olfr366 UTSW 2 37219587 missense possibly damaging 0.77
R5433:Olfr366 UTSW 2 37219672 missense probably damaging 1.00
R5499:Olfr366 UTSW 2 37219765 missense possibly damaging 0.81
R6330:Olfr366 UTSW 2 37220124 missense probably benign 0.00
R6338:Olfr366 UTSW 2 37219822 missense probably damaging 1.00
R6666:Olfr366 UTSW 2 37220319 missense probably damaging 1.00
R6872:Olfr366 UTSW 2 37219977 missense possibly damaging 0.60
R7412:Olfr366 UTSW 2 37219762 missense possibly damaging 0.48
R7789:Olfr366 UTSW 2 37219660 missense probably benign 0.01
R7831:Olfr366 UTSW 2 37219711 missense probably damaging 0.98
R8220:Olfr366 UTSW 2 37219779 missense probably benign 0.06
R8391:Olfr366 UTSW 2 37220265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGGACATCTGCTTTACCAC -3'
(R):5'- GTGAAGGCCAAGAGCTCATTG -3'

Sequencing Primer
(F):5'- ACTGTCATCGTGCCACAGATG -3'
(R):5'- CCAAGAGCTCATTGATAGAGGTGTC -3'
Posted On2017-01-03