Incidental Mutation 'R3725:Tmod1'
ID270722
Institutional Source Beutler Lab
Gene Symbol Tmod1
Ensembl Gene ENSMUSG00000028328
Gene Nametropomodulin 1
Synonymserythrocyte tropomodulin, E-Tmod
MMRRC Submission 040716-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3725 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46038935-46116032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46097026 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 273 (V273A)
Ref Sequence ENSEMBL: ENSMUSP00000103402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107773]
Predicted Effect probably benign
Transcript: ENSMUST00000107773
AA Change: V273A

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103402
Gene: ENSMUSG00000028328
AA Change: V273A

DomainStartEndE-ValueType
Pfam:Tropomodulin 3 143 6.3e-64 PFAM
PDB:1IO0|A 160 344 1e-115 PDB
SCOP:d1a4ya_ 181 312 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155730
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tropomodulin family. The encoded protein is an actin-capping protein that regulates tropomyosin by binding to its N-terminus, inhibiting depolymerization and elongation of the pointed end of actin filaments and thereby influencing the structure of the erythrocyte membrane skeleton. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous inactivation of this locus results in aborted heart development and consequent embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 T A 7: 139,983,868 R740S possibly damaging Het
Adamtsl3 A C 7: 82,612,404 D1676A possibly damaging Het
Atp6v1a A G 16: 44,101,757 probably benign Het
Camsap3 T C 8: 3,603,785 L485P probably damaging Het
Ccdc81 A T 7: 89,866,630 F614I possibly damaging Het
Cdk5rap2 C A 4: 70,235,437 K1716N possibly damaging Het
Cfh T C 1: 140,086,496 M1197V probably damaging Het
Cyp3a11 A G 5: 145,866,000 F228L probably benign Het
Ddx24 A G 12: 103,417,605 M575T probably benign Het
Dhx36 A T 3: 62,488,222 probably benign Het
Dmxl2 T A 9: 54,393,769 I1554L probably damaging Het
Dsp A G 13: 38,194,689 probably null Het
Dsp A G 13: 38,197,618 S2181G probably benign Het
Epg5 T C 18: 78,017,679 I1959T probably benign Het
Fam135a T A 1: 24,057,434 K77* probably null Het
Fam208b T C 13: 3,590,538 I200V probably benign Het
Fam209 T C 2: 172,473,995 S97P probably benign Het
Fbxo11 A G 17: 88,009,286 V323A probably benign Het
Fzd5 A G 1: 64,736,339 S88P probably damaging Het
Galnt12 A T 4: 47,104,140 T133S probably damaging Het
Gja8 A G 3: 96,919,845 L167P probably damaging Het
Gm7173 T A X: 79,510,015 T285S probably damaging Het
Gm8730 T C 8: 102,865,032 noncoding transcript Het
Gsdmd A G 15: 75,866,090 D247G probably benign Het
Iqcg A G 16: 33,020,539 probably null Het
Lamb1 C T 12: 31,321,075 A1375V probably null Het
Mlip A G 9: 77,190,380 S282P probably damaging Het
Nfxl1 A T 5: 72,517,062 D831E probably damaging Het
Nipbl T C 15: 8,295,661 D2506G probably damaging Het
Olfr1355 T A 10: 78,879,932 Y253* probably null Het
Olfr805 A T 10: 129,723,115 V143D probably damaging Het
Pcdhb9 T C 18: 37,401,601 L216P possibly damaging Het
Pigc G A 1: 161,971,291 G281R possibly damaging Het
Polr3g C T 13: 81,694,635 R87H probably damaging Het
Ppfia4 T C 1: 134,313,711 D502G probably benign Het
Psg18 T A 7: 18,354,823 probably benign Het
Rad9a G A 19: 4,197,695 R179C probably damaging Het
Rxra A G 2: 27,754,277 D327G probably damaging Het
Samd7 T C 3: 30,751,134 V22A possibly damaging Het
Slc22a29 A T 19: 8,218,609 V22D possibly damaging Het
Slmap C A 14: 26,427,242 R671S probably damaging Het
Smarcal1 T C 1: 72,626,596 F751S possibly damaging Het
Smarcb1 T A 10: 75,916,786 K73N probably benign Het
Sptssa T C 12: 54,656,395 E30G probably damaging Het
Stpg2 A G 3: 139,317,477 K418R probably benign Het
Tmem19 A G 10: 115,359,770 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Uggt1 A T 1: 36,182,507 L43* probably null Het
Vmn1r205 A T 13: 22,592,501 F144I probably damaging Het
Vmn2r54 G A 7: 12,632,296 T237I probably benign Het
Vmn2r7 A T 3: 64,724,991 F17I possibly damaging Het
Vpreb3 G A 10: 75,943,291 probably null Het
Vps13d T A 4: 145,115,648 probably benign Het
Zkscan5 A T 5: 145,220,913 R742W probably damaging Het
Other mutations in Tmod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03375:Tmod1 APN 4 46096999 missense probably damaging 1.00
R1445:Tmod1 UTSW 4 46090884 missense probably damaging 1.00
R1513:Tmod1 UTSW 4 46083549 missense possibly damaging 0.61
R1888:Tmod1 UTSW 4 46097069 synonymous silent
R1980:Tmod1 UTSW 4 46061043 missense probably damaging 1.00
R2914:Tmod1 UTSW 4 46092259 missense probably damaging 1.00
R3726:Tmod1 UTSW 4 46097026 missense probably benign 0.11
R3952:Tmod1 UTSW 4 46078315 missense probably damaging 0.98
R4854:Tmod1 UTSW 4 46090920 missense possibly damaging 0.80
R4989:Tmod1 UTSW 4 46090872 missense probably damaging 0.97
R6254:Tmod1 UTSW 4 46078469 splice site probably null
R7212:Tmod1 UTSW 4 46093951 nonsense probably null
R7570:Tmod1 UTSW 4 46083632 missense probably benign 0.15
R7572:Tmod1 UTSW 4 46083593 missense possibly damaging 0.53
Z1176:Tmod1 UTSW 4 46092271 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCCAGCAGGAGTGTTCAG -3'
(R):5'- GACAGGAACACAGTAGACTCTG -3'

Sequencing Primer
(F):5'- GCTATGCTTAGAAAGGTAGTGCC -3'
(R):5'- TAGACTCTGGGGCATCTACCATCAG -3'
Posted On2015-03-18